ID: 1081598189

View in Genome Browser
Species Human (GRCh38)
Location 11:44473648-44473670
Sequence GAGGCTAGGCCCTCGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081598178_1081598189 1 Left 1081598178 11:44473624-44473646 CCCTCACTCAAGCCCTCCAGGTA No data
Right 1081598189 11:44473648-44473670 GAGGCTAGGCCCTCGGGAGGTGG No data
1081598176_1081598189 28 Left 1081598176 11:44473597-44473619 CCTGTTTGAGTTTGCTTGCGGAC No data
Right 1081598189 11:44473648-44473670 GAGGCTAGGCCCTCGGGAGGTGG No data
1081598179_1081598189 0 Left 1081598179 11:44473625-44473647 CCTCACTCAAGCCCTCCAGGTAG No data
Right 1081598189 11:44473648-44473670 GAGGCTAGGCCCTCGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081598189 Original CRISPR GAGGCTAGGCCCTCGGGAGG TGG Intergenic
No off target data available for this crispr