ID: 1081600302

View in Genome Browser
Species Human (GRCh38)
Location 11:44488205-44488227
Sequence CTCCAGTGGAGGCCGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081600302_1081600310 -8 Left 1081600302 11:44488205-44488227 CCAGGGCCCGGCCTCCACTGGAG No data
Right 1081600310 11:44488220-44488242 CACTGGAGGGCAGTGGCATCTGG No data
1081600302_1081600311 7 Left 1081600302 11:44488205-44488227 CCAGGGCCCGGCCTCCACTGGAG No data
Right 1081600311 11:44488235-44488257 GCATCTGGTTCTGCTTTGCTTGG No data
1081600302_1081600312 8 Left 1081600302 11:44488205-44488227 CCAGGGCCCGGCCTCCACTGGAG No data
Right 1081600312 11:44488236-44488258 CATCTGGTTCTGCTTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081600302 Original CRISPR CTCCAGTGGAGGCCGGGCCC TGG (reversed) Intergenic
No off target data available for this crispr