ID: 1081600370

View in Genome Browser
Species Human (GRCh38)
Location 11:44488536-44488558
Sequence GGTGCCACTGGGGCTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081600370_1081600380 15 Left 1081600370 11:44488536-44488558 CCAGCACCAGCCCCAGTGGCACC No data
Right 1081600380 11:44488574-44488596 CAACTCTCTTCTGCCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081600370 Original CRISPR GGTGCCACTGGGGCTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr