ID: 1081602923

View in Genome Browser
Species Human (GRCh38)
Location 11:44507724-44507746
Sequence CCAATTATCCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081602917_1081602923 17 Left 1081602917 11:44507684-44507706 CCAAAATGGCTGCTTGAGCTCCA No data
Right 1081602923 11:44507724-44507746 CCAATTATCCAGAAGGAGGAAGG No data
1081602916_1081602923 18 Left 1081602916 11:44507683-44507705 CCCAAAATGGCTGCTTGAGCTCC No data
Right 1081602923 11:44507724-44507746 CCAATTATCCAGAAGGAGGAAGG No data
1081602918_1081602923 -3 Left 1081602918 11:44507704-44507726 CCAGACATCAAGTCCGCTTTCCA No data
Right 1081602923 11:44507724-44507746 CCAATTATCCAGAAGGAGGAAGG No data
1081602915_1081602923 26 Left 1081602915 11:44507675-44507697 CCTCATGGCCCAAAATGGCTGCT No data
Right 1081602923 11:44507724-44507746 CCAATTATCCAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081602923 Original CRISPR CCAATTATCCAGAAGGAGGA AGG Intergenic
No off target data available for this crispr