ID: 1081603966

View in Genome Browser
Species Human (GRCh38)
Location 11:44515228-44515250
Sequence AAATGTCCCCAGCTGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081603961_1081603966 5 Left 1081603961 11:44515200-44515222 CCTGAGTGGATGCTGGGAACAAT No data
Right 1081603966 11:44515228-44515250 AAATGTCCCCAGCTGGGGCAAGG No data
1081603958_1081603966 16 Left 1081603958 11:44515189-44515211 CCATGGGAGAGCCTGAGTGGATG No data
Right 1081603966 11:44515228-44515250 AAATGTCCCCAGCTGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081603966 Original CRISPR AAATGTCCCCAGCTGGGGCA AGG Intergenic
No off target data available for this crispr