ID: 1081609059

View in Genome Browser
Species Human (GRCh38)
Location 11:44547850-44547872
Sequence AGTTATCTGTAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081609059_1081609064 16 Left 1081609059 11:44547850-44547872 CCTGCCATCTTCTACAGATAACT No data
Right 1081609064 11:44547889-44547911 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1081609059_1081609065 25 Left 1081609059 11:44547850-44547872 CCTGCCATCTTCTACAGATAACT No data
Right 1081609065 11:44547898-44547920 GGCCTGTTACTGGGCTTTGATGG No data
1081609059_1081609061 4 Left 1081609059 11:44547850-44547872 CCTGCCATCTTCTACAGATAACT No data
Right 1081609061 11:44547877-44547899 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1081609059_1081609063 15 Left 1081609059 11:44547850-44547872 CCTGCCATCTTCTACAGATAACT No data
Right 1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081609059 Original CRISPR AGTTATCTGTAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr