ID: 1081614592

View in Genome Browser
Species Human (GRCh38)
Location 11:44583128-44583150
Sequence CCTAGCATTGGGAGGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081614583_1081614592 10 Left 1081614583 11:44583095-44583117 CCGGCACTGTGAATCTGAGTGTG 0: 1
1: 0
2: 0
3: 17
4: 199
Right 1081614592 11:44583128-44583150 CCTAGCATTGGGAGGGAGTGGGG 0: 1
1: 0
2: 2
3: 29
4: 298
1081614582_1081614592 15 Left 1081614582 11:44583090-44583112 CCATTCCGGCACTGTGAATCTGA 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1081614592 11:44583128-44583150 CCTAGCATTGGGAGGGAGTGGGG 0: 1
1: 0
2: 2
3: 29
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081614592 Original CRISPR CCTAGCATTGGGAGGGAGTG GGG Intronic
900469942 1:2848825-2848847 CCGTGCCTTGGGTGGGAGTGTGG + Intergenic
900577749 1:3392106-3392128 CCTGGCCTTGGGAGAGAGAGAGG - Intronic
900898148 1:5498244-5498266 CCTAGCATGGGGAGGGAATGTGG - Intergenic
900983486 1:6059771-6059793 CCTAGAGTTGGAAGTGAGTGGGG + Intronic
901193213 1:7424948-7424970 CCCTGCATAGGGAGGGAGGGAGG + Intronic
901420837 1:9150164-9150186 TCCAGCATTGAGAGGGAGGGAGG + Intergenic
902056885 1:13608303-13608325 CCAGGCATTGGGAGGGATTGAGG + Intronic
902315870 1:15617865-15617887 AGTAGCAAAGGGAGGGAGTGAGG - Intronic
902565917 1:17311330-17311352 CCCAGCATTTGGAGGCAGGGTGG - Intronic
902839088 1:19064191-19064213 CCTAGCATTGGCAGAGAGATGGG + Intergenic
902868903 1:19300709-19300731 CCTAGGACTGAGAGGGAGTTTGG - Intergenic
904611329 1:31727818-31727840 TCCAGGATTGGGAGGGAGAGTGG - Intronic
905334130 1:37232350-37232372 CCTAGCATTGGGTGTGCCTGGGG + Intergenic
907420285 1:54342518-54342540 CCTGGGAATGGGAGGGGGTGGGG - Intronic
907650139 1:56287050-56287072 CCTAGGTTGGAGAGGGAGTGAGG - Intergenic
910216129 1:84846950-84846972 CCTAGAAATGGGAGGGTATGAGG + Intronic
910659891 1:89660501-89660523 CCTAGGATAGGGAGGAAGAGTGG - Intronic
910875783 1:91876439-91876461 CCTAGCATTTGGATGATGTGTGG - Intronic
912544109 1:110438658-110438680 CTTAGCATTTGGAAGGATTGTGG + Intergenic
913558134 1:119990304-119990326 CCTAGGGCTGGGAGGGAGTTAGG + Intronic
913639708 1:120800148-120800170 CCTAGGGCTGGGAGGGAGTTAGG - Intergenic
914375864 1:147073059-147073081 ATTAGGATTGGGAGGGAGGGAGG + Intergenic
914626859 1:149470483-149470505 CCTAGGGCTGGGAGGGAGTTAGG - Intergenic
915302527 1:154959577-154959599 CATAGGATTGGGAGGGAAGGGGG + Exonic
915747963 1:158179722-158179744 CTAGGCATTGGGAGGGGGTGAGG + Intergenic
917086321 1:171308618-171308640 CCTAGAATTGGGATGTTGTGGGG - Intergenic
917506576 1:175632890-175632912 CCTTGTATAGGGAGGCAGTGTGG - Intronic
919395118 1:197036406-197036428 AGAAGCAATGGGAGGGAGTGGGG - Intergenic
921152193 1:212411613-212411635 CCCTGAATTGGGAGGGAGAGGGG + Intronic
922535124 1:226373865-226373887 CCTAGCATTTGGGGAGACTGAGG + Intronic
923402361 1:233627605-233627627 CCTCGCAGTGGGAGGGTGGGCGG + Intronic
924448361 1:244155406-244155428 CCCAGCTTTAGGAGGGAGGGAGG + Intergenic
924536059 1:244937039-244937061 ACTAGAATTGGGAGGGATGGAGG + Intergenic
1062974228 10:1671880-1671902 ACTTGCACTGGGGGGGAGTGGGG + Intronic
1063553582 10:7056703-7056725 CCTGGGAATGGGAGGGAATGGGG + Intergenic
1064976425 10:21121645-21121667 CCTAGCATTGGGTAGGAGATTGG - Intronic
1065077682 10:22097692-22097714 CCAAGGATGGGGAGGGAGGGAGG - Intergenic
1067459150 10:46444664-46444686 TCAAGCATGGGGTGGGAGTGAGG + Intergenic
1067628046 10:47939966-47939988 TCAAGCATGGGGTGGGAGTGAGG - Intergenic
1069744876 10:70708795-70708817 CCTAGGACTTGGGGGGAGTGGGG + Intronic
1069774309 10:70917963-70917985 CCCTGGTTTGGGAGGGAGTGGGG - Intergenic
1070493535 10:76999734-76999756 GGTTGCATTGAGAGGGAGTGTGG - Intronic
1070545027 10:77445600-77445622 CCAAGCATTGGGAGAAAGGGAGG + Intronic
1070830952 10:79417835-79417857 CCTTGGAATGGGAGGGAGTGGGG + Intronic
1071263363 10:83941505-83941527 CCTACTATTGGAAGGGAATGGGG - Intergenic
1072639073 10:97197170-97197192 CTCAGCCTTGGGAAGGAGTGGGG - Intronic
1072906994 10:99463497-99463519 CCTATCATAGGGAAGGAGTTGGG - Intergenic
1074293796 10:112162978-112163000 AGTAGCATTGGCAGGGGGTGCGG + Intronic
1074331825 10:112519897-112519919 CCTAGCATTGGGAAGGAAAAGGG - Intronic
1075626289 10:123966553-123966575 CCTAGGATGGAGGGGGAGTGGGG + Intergenic
1076425530 10:130364752-130364774 CTTAGCCTTCAGAGGGAGTGTGG + Intergenic
1077936824 11:6796873-6796895 TATAGCATTGGGAGAGAGTGTGG + Intergenic
1080434030 11:32223468-32223490 CCTAGCAGTGGGAGGCACTGGGG + Intergenic
1081173262 11:39893929-39893951 CCTAGACTTGGGAGGGGGTGTGG - Intergenic
1081603690 11:44513293-44513315 CCAGGCATTGGGGGAGAGTGAGG + Intergenic
1081614592 11:44583128-44583150 CCTAGCATTGGGAGGGAGTGGGG + Intronic
1083207420 11:61161189-61161211 CCTCGCGGTGGGAGGGAGGGAGG - Intronic
1084453218 11:69252203-69252225 AATAGCATGGGGAGGGAGGGAGG - Intergenic
1084474896 11:69383275-69383297 CCTAGGAGAGGGAGGGACTGTGG - Intergenic
1085402575 11:76243514-76243536 CATGGAAATGGGAGGGAGTGCGG + Intergenic
1085474927 11:76783563-76783585 CCTAGGGCTGGGCGGGAGTGGGG + Intronic
1088850496 11:113699823-113699845 CCCAGATTAGGGAGGGAGTGGGG + Intronic
1089112193 11:116065549-116065571 CCTGGGATTGGGAGGGAATTGGG + Intergenic
1089356673 11:117858407-117858429 CCTGACATGGAGAGGGAGTGAGG - Intronic
1090280255 11:125449843-125449865 CCAAGAATTAGGAGTGAGTGAGG + Intronic
1090464539 11:126922579-126922601 CCTAGAAGTGGGAGGGAAAGGGG - Intronic
1091016423 11:132055077-132055099 CATGGCATTGGAATGGAGTGAGG + Intronic
1091237165 11:134030027-134030049 CGTAGCATATGGAGGGCGTGGGG + Intergenic
1091692869 12:2609058-2609080 ACTAGAACTGTGAGGGAGTGAGG + Intronic
1094204180 12:27823262-27823284 CCCAGCATCGTGAGAGAGTGTGG + Intergenic
1095734112 12:45537525-45537547 CCAGGCATTTGGAGGGAGTTGGG - Intergenic
1096216157 12:49798512-49798534 CCTGGCTTTGCGAGGGAGTAGGG - Intronic
1097054655 12:56242405-56242427 GCTAGGAGTGGGAGGGAATGGGG + Exonic
1099784218 12:87239385-87239407 GCTAGAGTTGGGAGGGAGAGTGG + Intergenic
1101308756 12:103556980-103557002 CAGAGCCTTTGGAGGGAGTGTGG + Intergenic
1101677623 12:106932943-106932965 CATAGAATTGGAAGGGAGTTAGG - Intergenic
1101999498 12:109548007-109548029 CCTAGACTGGGGATGGAGTGGGG + Intergenic
1103343966 12:120237050-120237072 CCTAGCACTGTGAGAGACTGAGG - Intronic
1103894733 12:124265391-124265413 ACTTGCATGGGGAGAGAGTGTGG + Intronic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1106807562 13:33326240-33326262 CCTAGCATAGGGAGTGGGTGAGG - Intronic
1109127772 13:58539395-58539417 CCTGTCAGTGGGCGGGAGTGAGG + Intergenic
1110199963 13:72838339-72838361 CCTAGCCTTGGGAGGAATTGGGG + Intronic
1112020622 13:95368080-95368102 CCTAGCTCTGGGAGCGGGTGTGG - Intergenic
1112364564 13:98745671-98745693 CAGAGCCTTCGGAGGGAGTGTGG + Intronic
1112498576 13:99924976-99924998 CCTAGCATTTTGAGAGACTGAGG - Intergenic
1112903750 13:104391828-104391850 TCTAGGTTTGGGAGGGAGAGGGG - Intergenic
1113581949 13:111436281-111436303 CCAAACATCTGGAGGGAGTGAGG - Intergenic
1114212485 14:20626951-20626973 CGAAGGGTTGGGAGGGAGTGGGG + Intergenic
1117195316 14:53334472-53334494 CCCAGGATTGAGAGGGAGAGAGG - Intergenic
1117293294 14:54354285-54354307 ACTTGCATGGGGAGGGGGTGGGG - Intergenic
1118776932 14:68979122-68979144 CCTGGCGTGGGGAGGGAGTAGGG + Exonic
1119764890 14:77182019-77182041 CCTTGCATTGGGAGGGATGGGGG + Intronic
1121017546 14:90557682-90557704 CCGAGCATAGGCAGGGAATGGGG - Intronic
1122315637 14:100824723-100824745 CCGAGCCTTGGGACGGCGTGTGG - Intergenic
1122720255 14:103717773-103717795 CCTAGCATTGGGTGGGCTTGGGG + Intronic
1122941310 14:104982641-104982663 CCCAGCTTTGGGGGAGAGTGAGG - Intergenic
1123493764 15:20802290-20802312 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1123495112 15:20816522-20816544 CCCTGCATTGGGTGGGAGTGAGG + Intergenic
1123550263 15:21371355-21371377 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1123551604 15:21385615-21385637 CCCTGCATTGGGTGGGAGTGAGG + Intergenic
1124029768 15:25999825-25999847 CCTAGCAATGAGAGAGAGAGAGG - Intergenic
1125077093 15:35632407-35632429 GGAAGCATTGTGAGGGAGTGAGG + Intergenic
1125728273 15:41879221-41879243 GGTGGCATTGGGAGGCAGTGAGG - Intronic
1128532748 15:68465661-68465683 CCTTGCAATGGGAGGGAGTGTGG - Intergenic
1131087066 15:89585760-89585782 CATAGCACTGGCAGAGAGTGGGG - Exonic
1131681952 15:94732740-94732762 GCTTGCAGTGGGAGGGAGGGGGG + Intergenic
1132348628 15:101123359-101123381 CCAAGCAATGGGAGTGAGGGTGG - Intergenic
1202958604 15_KI270727v1_random:98610-98632 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1202959946 15_KI270727v1_random:112857-112879 CCCTGCATTGGGTGGGAGTGAGG + Intergenic
1132611006 16:816327-816349 CCTGGCACTGGGAGGAGGTGAGG + Intergenic
1132642147 16:982786-982808 CCACCCATGGGGAGGGAGTGCGG + Intronic
1133337096 16:5013289-5013311 CCTAGGGTTGGGAGAGAGGGTGG + Intronic
1134101368 16:11454341-11454363 GGTCGCATTGGGAGGGATTGGGG - Intronic
1134309555 16:13063254-13063276 CCTAGCATTTGGGGAGACTGAGG - Intronic
1135697910 16:24606452-24606474 CCTAACATTTAGAGGGAGAGAGG - Intergenic
1135755889 16:25097849-25097871 TCTAACATTAGGAGGGAGAGTGG - Intergenic
1136052197 16:27659766-27659788 CTGAGGAATGGGAGGGAGTGTGG + Intronic
1136569421 16:31087872-31087894 CCTAGCTTTGGGGAGGAGAGGGG + Intronic
1138440225 16:57029911-57029933 CCTTGCCTTGCAAGGGAGTGGGG - Intronic
1141034940 16:80618657-80618679 CCCAGCCTGGGGAGGGCGTGGGG - Intronic
1141633312 16:85300903-85300925 CCCAGAATTTGGGGGGAGTGGGG + Intergenic
1141635590 16:85312363-85312385 CCGAGCCTTGGAAGGGAGGGCGG - Intergenic
1143536172 17:7541356-7541378 CCTACCAGCAGGAGGGAGTGCGG - Intergenic
1143918720 17:10313987-10314009 CCCTCCAATGGGAGGGAGTGAGG - Intronic
1144444050 17:15309909-15309931 CCTTGCACTGGAAGGGAATGAGG - Intronic
1146307801 17:31743965-31743987 CACAGCATTGGGAGGGAGGAGGG - Intergenic
1147498995 17:40944188-40944210 GGTAGGAGTGGGAGGGAGTGAGG - Intergenic
1147538635 17:41337184-41337206 ACTGGGAATGGGAGGGAGTGTGG - Intergenic
1147952907 17:44116975-44116997 CGTGGCATTGGGTGGGAGTGGGG - Intronic
1148622626 17:49045773-49045795 CCTAGGATGGGGAGGGCCTGTGG + Intronic
1148713164 17:49696644-49696666 CCTGGCATTGGCAGGAAGGGCGG - Intergenic
1149043558 17:52218739-52218761 GGGAGCAGTGGGAGGGAGTGGGG + Intergenic
1149626110 17:58082329-58082351 CCTGGGAGTGGGATGGAGTGAGG + Intergenic
1150333811 17:64315451-64315473 CCTAGGATTGGGAGGAAGTAAGG + Intergenic
1153256396 18:3175941-3175963 CACAGCATTGGGATGAAGTGGGG + Intronic
1153555837 18:6312432-6312454 CCTAGAACTGGGAGGCAGTGTGG - Intronic
1153968180 18:10200875-10200897 TCCAGCATGGGGAGGGTGTGTGG + Intergenic
1154303857 18:13217370-13217392 CCGAGCCCTGGGCGGGAGTGCGG + Intergenic
1154451292 18:14476745-14476767 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1155543337 18:26888812-26888834 CCTAGCATCCGGAGGGGGAGAGG + Intergenic
1157307890 18:46530253-46530275 CCTTGTCCTGGGAGGGAGTGAGG + Intronic
1158007683 18:52691812-52691834 CCCAGGATAGGGTGGGAGTGAGG - Intronic
1158563195 18:58532558-58532580 CCTAGCATTAGGAGAAAGAGTGG - Intronic
1159607022 18:70485425-70485447 CAGAGCACTGAGAGGGAGTGTGG - Intergenic
1160436925 18:78858938-78858960 ACCAGCAGTGGGAGGGAGGGAGG + Intergenic
1163149090 19:15400658-15400680 ACCAGCATGGGGAGGCAGTGTGG - Intronic
1163223874 19:15940965-15940987 CCCAGCAATGGGAGGGATGGGGG + Intergenic
1165062602 19:33212196-33212218 CCGAGCCTTGGGTGGCAGTGGGG + Intronic
1165073762 19:33269698-33269720 CCTGGCCTTGGGATGGGGTGTGG + Intergenic
1165352712 19:35284879-35284901 CTTAGCATGGGGAGGGAGCAGGG - Intronic
1165935347 19:39385367-39385389 CCTGGCACTGGGAGGTGGTGAGG + Intronic
1166202668 19:41248665-41248687 CCTATAGTTGGGTGGGAGTGTGG - Intronic
1166310945 19:41962288-41962310 CCTAGGAGTGGGAGGGTGGGGGG + Intergenic
1166647560 19:44543459-44543481 CCAAGCCTGGGGTGGGAGTGTGG - Intergenic
1166695159 19:44847849-44847871 CATAGCAATGGGAGGGACGGGGG - Intronic
1166985787 19:46659521-46659543 TCTAACTTTGGGAGGGGGTGGGG + Intronic
1167889719 19:52529646-52529668 CCTAGGATTGGGAGGATGTGGGG + Intronic
925595086 2:5547658-5547680 CTTAGCATTGCCAAGGAGTGTGG + Intergenic
925722132 2:6839596-6839618 CCAAACATTGGGAGAGACTGTGG - Intergenic
926121892 2:10245766-10245788 CCTGGCCTTGGCAGGGAGTGGGG + Intergenic
929024639 2:37587956-37587978 CCTAGCATTGTGGGAGACTGAGG - Intergenic
930601103 2:53444192-53444214 GCTAGCCTTGGGAGAGAATGAGG - Intergenic
931387241 2:61808797-61808819 GCAAGATTTGGGAGGGAGTGGGG + Intergenic
935140350 2:100347966-100347988 CCCAGCATTGTGAGAGACTGAGG + Intergenic
935325771 2:101935583-101935605 CCTAGCCAAGGGAGGGTGTGAGG + Intergenic
936933271 2:117812276-117812298 CCTAGCCTTGGGAAGGGGTCTGG - Intergenic
936944798 2:117920722-117920744 CCTACTATGGTGAGGGAGTGGGG + Intronic
937933772 2:127226250-127226272 ACTAGCATTGCTAGGGAATGTGG - Intergenic
938263503 2:129911051-129911073 CTGAGCACTGGGAGGAAGTGTGG + Intergenic
938948356 2:136234908-136234930 CCTAGCAGTGGGAGTAAGTTTGG + Intergenic
941268079 2:163388879-163388901 CTTTGCATTGGGAAGGAGTGTGG + Intergenic
941918854 2:170829644-170829666 GCTAGCATGGGGCGGGAGTGGGG - Intronic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942464475 2:176192973-176192995 CCTATCATTTGAAGGGAGTTAGG + Intergenic
942488018 2:176459549-176459571 GATAGCATAGGGAGGGACTGCGG + Intergenic
943666498 2:190614899-190614921 CCTGGCATCTGGAGGGAATGGGG + Intergenic
944614639 2:201447991-201448013 CCTAGCATTGGCACAGTGTGTGG + Intronic
944915346 2:204354753-204354775 ACTAGGATTGGGAGGGTTTGGGG - Intergenic
945815106 2:214595974-214595996 CCTAGTATTTGGGGGGAGGGGGG + Intergenic
946502356 2:220263137-220263159 TCCAGCATTGAGAGGGAGTTAGG + Intergenic
946623949 2:221591148-221591170 ATTAGCATGGGGAGGGAGTCTGG - Intergenic
947449568 2:230194817-230194839 CTTATCATAGGGAGGGAATGGGG - Intronic
948612040 2:239176164-239176186 CCGGGCAGAGGGAGGGAGTGGGG - Intronic
948942042 2:241201536-241201558 CCTGGGATTGGGAAGGGGTGGGG + Intronic
1169128446 20:3148394-3148416 TCTAGCATTGAATGGGAGTGAGG + Exonic
1170609750 20:17902801-17902823 CCAAGCTCTGGGAGAGAGTGGGG + Intergenic
1172215558 20:33233318-33233340 TCTGGCTCTGGGAGGGAGTGTGG - Intergenic
1172621695 20:36321701-36321723 ACGAGCATGGGGAGGGAGCGAGG + Intronic
1173911358 20:46673407-46673429 CCCAGCAATGGAAGGGAATGGGG - Intronic
1175492109 20:59386191-59386213 CTTAGACTTGGGAGGGAGGGTGG + Intergenic
1176172613 20:63702822-63702844 CCTCGCACAGGGAGGGAGTGTGG + Intronic
1176443515 21:6799288-6799310 CCCTGCATTGGGTGGGAGTGAGG - Intergenic
1176444851 21:6813484-6813506 CTTAAGATTGTGAGGGAGTGTGG + Intergenic
1176823017 21:13678517-13678539 CTTAAGATTGTGAGGGAGTGTGG + Intergenic
1177162832 21:17567066-17567088 CTTAAGATTGTGAGGGAGTGTGG + Exonic
1177441909 21:21136716-21136738 CCTAGCACTTTGAGGGACTGAGG - Intronic
1178250460 21:30998888-30998910 CCTGACATTGGCAAGGAGTGAGG + Intergenic
1179080336 21:38164963-38164985 CCAAACATGGGGAGGGAGGGAGG + Intronic
1179562070 21:42221784-42221806 CCTAGCATTAGGAGGAAGTCAGG - Intronic
1179620712 21:42613969-42613991 CCTGGGATTTGGAGGGAGAGGGG - Intergenic
1179807867 21:43851488-43851510 ACAAGCATGGGAAGGGAGTGAGG + Intergenic
1180164514 21:46017031-46017053 TCTAGCAAAGGGAGGGAGGGAGG + Intergenic
1181029036 22:20141201-20141223 CCTTGGACTGGGAGGGAGCGGGG - Exonic
1181258157 22:21577807-21577829 CCTAGCATAGGTAGGCAGAGCGG + Intronic
1181925367 22:26354404-26354426 CACAGCATTCAGAGGGAGTGTGG + Intronic
1184228807 22:43146758-43146780 CCTAGAGGTGGGAAGGAGTGAGG + Intergenic
949849812 3:8411542-8411564 CCTGGCAGTGGTAGGGAGCGGGG - Intergenic
950469752 3:13177340-13177362 CCCAGCATGGGGATGGGGTGGGG - Intergenic
951918968 3:27832538-27832560 CCTTGCATTGGGAAGGTGTTTGG + Intergenic
955528984 3:59852682-59852704 CCAAGGATTAGGAGGGAGGGAGG - Intronic
955898352 3:63725160-63725182 CCCAGGATTGCGAGGGTGTGAGG + Intergenic
956286302 3:67613977-67613999 CCAGGCTTTGGGAGGGAGGGAGG + Intronic
957226231 3:77451511-77451533 GCTAGCATTGGGATGCAATGTGG - Intronic
961023222 3:123528006-123528028 CCTAGAATTTGGGGAGAGTGAGG + Intronic
961079480 3:124013789-124013811 CTTGGCATGGTGAGGGAGTGAGG + Intergenic
964421884 3:156511890-156511912 CCCAGCAATGGGAGGGAAGGAGG - Intronic
965667243 3:171108474-171108496 CATATCATTGGGTTGGAGTGAGG - Intronic
966198161 3:177334342-177334364 CTTAGGAGTGGGAGGGAATGGGG + Intergenic
966918043 3:184595427-184595449 CCAAGCATTGAGAGGGGCTGTGG - Intronic
968463197 4:736296-736318 CCTAGCATTTGGGGAGACTGAGG - Intronic
968507809 4:979824-979846 CTTTGCCTCGGGAGGGAGTGTGG - Intronic
969075867 4:4577250-4577272 CCTAGCATGGGGAGGAGGTGGGG - Intergenic
969390477 4:6888694-6888716 CCTAGCCCTGGGAGGGAGAAGGG - Intergenic
969458699 4:7315836-7315858 CCCAGCAGTGTGGGGGAGTGGGG + Intronic
969832274 4:9807408-9807430 CCTAGGATTAGCAGGGAATGTGG - Intronic
970559621 4:17269794-17269816 CCTGGCAGTGGGAGGGAATATGG - Intergenic
971279192 4:25227400-25227422 CCTAGCTTATGGAGGGACTGAGG - Intronic
974219460 4:58947859-58947881 CCTAGGTTTTGGAGGGTGTGTGG - Intergenic
975579143 4:75891398-75891420 CCTGGGGGTGGGAGGGAGTGGGG - Intronic
977572286 4:98641092-98641114 CCTAGCATTGGGAAGAGGAGGGG + Intronic
978780526 4:112548252-112548274 CCTTGCAATGGGAAGGAGAGAGG + Exonic
979359081 4:119740683-119740705 CCTAGCACTTGGAGGGGGTGAGG - Intergenic
979681499 4:123465251-123465273 CCTAGAATTGGGATGAGGTGGGG + Intergenic
983160056 4:164402060-164402082 ACTAGCATTTGAAGGGATTGGGG + Intergenic
983791084 4:171797973-171797995 ACTAGAAGTGGGAGGGAGGGAGG - Intergenic
984339989 4:178444901-178444923 ACTAGAAGTGGGAGGGAGAGAGG + Intergenic
985563291 5:602731-602753 CAGAGCCTCGGGAGGGAGTGGGG - Intergenic
987108798 5:14665317-14665339 CCTGGCACAGGGAGGAAGTGAGG + Intronic
989404363 5:41043630-41043652 CCTAGCATTGGGAGAAAATGTGG + Intronic
991191353 5:63878068-63878090 CCTTGCCTTGTGAGGGTGTGAGG - Intergenic
992459885 5:76951109-76951131 CCTAGAATTTGGTGGGAATGAGG + Intergenic
992958248 5:81932353-81932375 CCTATCATGAGGTGGGAGTGGGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
999715107 5:154354075-154354097 CCTAGCATTGTGAGATACTGTGG + Intronic
1001965574 5:175907681-175907703 AATACCATTGGAAGGGAGTGGGG - Intergenic
1002347300 5:178557029-178557051 CCTAGAACTGGGAGGGCTTGTGG - Intronic
1002439528 5:179257159-179257181 CCTTGAACTGGGAAGGAGTGTGG - Intronic
1002495006 5:179605829-179605851 CATAGCAGTGAGAGAGAGTGAGG - Intronic
1002554767 5:180027742-180027764 GGAAGCATTGGGTGGGAGTGTGG - Intronic
1002884009 6:1277758-1277780 CCTTGATCTGGGAGGGAGTGTGG - Intergenic
1003095206 6:3137219-3137241 CCGAGCAGAGGGAGGGAGGGAGG + Intronic
1003630404 6:7781459-7781481 CCTGGCTGTGGGAGGCAGTGTGG + Intronic
1004558126 6:16719877-16719899 CAGAGCTTCGGGAGGGAGTGTGG + Intronic
1005583598 6:27255056-27255078 CCAAGCAGTGGGAGCCAGTGCGG - Exonic
1006308656 6:33241301-33241323 CTTACCATGGGCAGGGAGTGGGG - Intergenic
1006375358 6:33668786-33668808 CCTGGCACTGTGGGGGAGTGGGG + Intronic
1007034660 6:38662229-38662251 CTTATCATTAGGAGGCAGTGGGG - Intergenic
1008049556 6:46886276-46886298 CCCAGCAGTGGGTGGCAGTGGGG + Intronic
1008352609 6:50510348-50510370 CATAGCATTGGGAAGAAGAGTGG - Intergenic
1010344884 6:74799764-74799786 CAGAGAATTGGTAGGGAGTGGGG + Intergenic
1011521208 6:88208948-88208970 CCCATCGTGGGGAGGGAGTGTGG - Intergenic
1011553194 6:88548524-88548546 CCTAGAGTCTGGAGGGAGTGTGG - Intergenic
1011576842 6:88810864-88810886 TCTAGCATTGGAAGGCAGTCAGG - Intronic
1016295270 6:142566738-142566760 CTTAGCATGGGGTGGGGGTGGGG - Intergenic
1016541363 6:145169913-145169935 CATAGCATTGCCAGGGGGTGGGG - Intergenic
1016918406 6:149266429-149266451 CCCAGCAAAGGGAAGGAGTGGGG - Intronic
1018830590 6:167439861-167439883 CAGAGCCTTTGGAGGGAGTGAGG + Intergenic
1019200589 6:170311080-170311102 CCCAGAATAGGGAGGGAGAGTGG + Intronic
1019412807 7:913988-914010 CCTAACAGAGGGATGGAGTGGGG + Intronic
1019937316 7:4264978-4265000 CCTGGCATTGGGTTGGGGTGGGG + Intronic
1020822783 7:12991083-12991105 CCTAGCACTGGGGGTGAGGGTGG + Intergenic
1021065389 7:16166528-16166550 CCTAGCATTTTGAGAGATTGAGG - Intronic
1022214611 7:28246167-28246189 CCTTGGATTGTGAGGGACTGTGG - Intergenic
1023582741 7:41699958-41699980 GCTGGCATTGGCAGGGGGTGGGG - Intronic
1023999494 7:45181320-45181342 CCTAGCTTTGGCTGGGAGTGGGG + Intronic
1024710713 7:52011709-52011731 CCTGGAAGTGGGCGGGAGTGAGG + Intergenic
1024713959 7:52053298-52053320 CCAAGCATCTGGAGGGAGGGAGG - Intergenic
1024922482 7:54574305-54574327 GTTGGCATTGGGAGGCAGTGGGG + Intergenic
1026185477 7:68079647-68079669 CTTAGCCCTGGGAGGGGGTGGGG + Intergenic
1026402857 7:70033436-70033458 CCATGCATTGGGAAGCAGTGTGG + Intronic
1026463676 7:70635615-70635637 CCTGGCAGTGGGAAGGAGAGAGG + Intronic
1027139773 7:75648784-75648806 CCTGGGAATGGGAGGCAGTGGGG + Intronic
1028267042 7:88738431-88738453 TCTCGAATTGGGAGGGAGGGAGG + Intergenic
1030267291 7:107633540-107633562 CCCAGCATTTGGAGGAAGAGAGG - Intergenic
1032505479 7:132431322-132431344 CCCAGGATTGGGAGGGGGAGAGG - Intronic
1034260912 7:149754921-149754943 CCTGGTATTGGGAGGGAATGGGG - Intergenic
1036787831 8:11699541-11699563 CCTTGGATGGGGAGGGAGAGAGG + Intronic
1038916307 8:32027473-32027495 CCTAGATTAGGGAGGGAGGGAGG - Intronic
1039122846 8:34168464-34168486 CCAAAAAGTGGGAGGGAGTGGGG - Intergenic
1040588791 8:48769938-48769960 CCTGGGGTTGGGAGGGAATGAGG + Intergenic
1040747518 8:50663332-50663354 TCAAGCATAGGGAGGGACTGAGG + Intronic
1041277857 8:56181560-56181582 CCTGTCATTGGCAGGGGGTGGGG + Intronic
1041301339 8:56415078-56415100 TCTAGCCTTGGAAGGCAGTGAGG - Intergenic
1041828257 8:62123175-62123197 AGTAGCACTGGGTGGGAGTGGGG - Intergenic
1046573672 8:115998381-115998403 CCTGGCATTGTGAGGATGTGAGG - Intergenic
1047178763 8:122567434-122567456 ACTAACATGGGGAGGGAGTTGGG - Intergenic
1047233204 8:123015392-123015414 CCCAGCACTGGGAGGAAATGTGG + Exonic
1048256207 8:132906930-132906952 CCTAGCCCTGAGAGGGAGCGGGG - Intronic
1049024684 8:139980300-139980322 CCTGGCATTGGTCAGGAGTGAGG - Intronic
1049413524 8:142484533-142484555 CCTAACATTTTGAGGAAGTGGGG - Intronic
1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG + Intergenic
1049779978 8:144424470-144424492 CCTGGCCTCGGGAGAGAGTGTGG - Intronic
1053459740 9:38259056-38259078 CACAGCCTTGGGAGGGGGTGTGG - Intergenic
1055331401 9:75187691-75187713 GGGAGCCTTGGGAGGGAGTGAGG + Intergenic
1058079364 9:100686141-100686163 CCTAGCATTGGTATGGAATTTGG - Intergenic
1059540425 9:115124913-115124935 CCTACCATTGGAAGGCTGTGGGG - Intergenic
1061584639 9:131557983-131558005 AATCGCACTGGGAGGGAGTGGGG + Intergenic
1061940841 9:133883012-133883034 CCTGGCATGGGGTGGGTGTGGGG - Intronic
1062168859 9:135122959-135122981 CCGATATTTGGGAGGGAGTGGGG + Intergenic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic
1203524346 Un_GL000213v1:71042-71064 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1203525685 Un_GL000213v1:85239-85261 CCCTGCATTGGGTGGGAGTGAGG + Intergenic
1186561581 X:10619008-10619030 CCTTGCCTTGGTAGGGACTGTGG - Intronic
1186749438 X:12606565-12606587 CCAAGCATAGAGAGGGACTGAGG - Intronic
1186898334 X:14027615-14027637 CATAGCATGGGGAAGGAGTAAGG + Intronic
1187249008 X:17580160-17580182 TCTGGCATTTGGAGAGAGTGGGG - Intronic
1187478173 X:19630221-19630243 CTTTGCAGTGGGAGGGAGCGGGG - Intronic
1188641035 X:32504753-32504775 ACTAGAGTGGGGAGGGAGTGAGG + Intronic
1189152945 X:38726312-38726334 CCCAGCCCTGGCAGGGAGTGGGG - Intergenic
1189463355 X:41259955-41259977 CCCTGCATTGAGAAGGAGTGGGG + Intergenic
1195680727 X:107544233-107544255 GCTAAGGTTGGGAGGGAGTGGGG + Intronic
1196766744 X:119252891-119252913 CTTGGCAGTGGGAGGGAGGGAGG - Intergenic
1198907819 X:141582001-141582023 CCTAGGATAGGGAAGGGGTGGGG + Intergenic
1198908972 X:141592423-141592445 CCTAGGATAGGGAAGGGGTGGGG - Intronic
1198918106 X:141695729-141695751 CCTAGGATAGGGAAGGGGTGGGG + Intronic
1200135909 X:153874573-153874595 CCTGGCGTTGGGAGGCAGTGAGG - Intronic
1200142734 X:153909943-153909965 CCAAGCTGTGGGAGGGGGTGTGG + Intronic
1201351119 Y:13042297-13042319 CCCAGTATAGGGAGGGATTGGGG + Intergenic
1201450442 Y:14106680-14106702 GATACCATTGGGAGGGAGGGTGG - Intergenic