ID: 1081619890

View in Genome Browser
Species Human (GRCh38)
Location 11:44613233-44613255
Sequence CATTTGCCCTGAAAGGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081619885_1081619890 -3 Left 1081619885 11:44613213-44613235 CCTTGACCAGTCCAACCATGCAT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619883_1081619890 4 Left 1081619883 11:44613206-44613228 CCCACTGCCTTGACCAGTCCAAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619876_1081619890 28 Left 1081619876 11:44613182-44613204 CCCTGCCTTCTAGGGTCCCTCGC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619879_1081619890 12 Left 1081619879 11:44613198-44613220 CCCTCGCCCCCACTGCCTTGACC 0: 1
1: 0
2: 2
3: 22
4: 282
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619882_1081619890 5 Left 1081619882 11:44613205-44613227 CCCCACTGCCTTGACCAGTCCAA 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619886_1081619890 -9 Left 1081619886 11:44613219-44613241 CCAGTCCAACCATGCATTTGCCC 0: 1
1: 0
2: 0
3: 9
4: 225
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619877_1081619890 27 Left 1081619877 11:44613183-44613205 CCTGCCTTCTAGGGTCCCTCGCC 0: 1
1: 0
2: 0
3: 7
4: 205
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619881_1081619890 6 Left 1081619881 11:44613204-44613226 CCCCCACTGCCTTGACCAGTCCA 0: 1
1: 0
2: 0
3: 17
4: 221
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619884_1081619890 3 Left 1081619884 11:44613207-44613229 CCACTGCCTTGACCAGTCCAACC 0: 1
1: 0
2: 0
3: 12
4: 202
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619878_1081619890 23 Left 1081619878 11:44613187-44613209 CCTTCTAGGGTCCCTCGCCCCCA 0: 1
1: 0
2: 0
3: 14
4: 109
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1081619880_1081619890 11 Left 1081619880 11:44613199-44613221 CCTCGCCCCCACTGCCTTGACCA 0: 1
1: 1
2: 2
3: 27
4: 336
Right 1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081619890 Original CRISPR CATTTGCCCTGAAAGGTCTC TGG Intronic
901349744 1:8583530-8583552 CTTTAGCCCTGCAAGGTCTCTGG - Intronic
902397489 1:16140274-16140296 CATTGGCCCTGCAAGAGCTCAGG + Intronic
908702669 1:66919586-66919608 CATGTGCCCACAAAGTTCTCAGG + Intronic
909792197 1:79693512-79693534 CATTTGGCCTCCAAGATCTCTGG + Intergenic
909922033 1:81393963-81393985 TATTTTCCCTGAAAGGTGTTAGG - Intronic
910116016 1:83732552-83732574 CATGTGCCCTGAAAGTACTTTGG + Intergenic
910469374 1:87535091-87535113 CATTTTCCTTAAAAGATCTCTGG - Intergenic
911277527 1:95879785-95879807 CATTTTTCCTCATAGGTCTCTGG + Intergenic
911490263 1:98556224-98556246 CATTTCCCCAGAAAGTTCACTGG - Intergenic
912737431 1:112162339-112162361 CACTTGCCTTCAAAGATCTCTGG - Intergenic
917088860 1:171331690-171331712 CGTTTGCCCTGAAAGCCTTCTGG - Exonic
917916789 1:179710114-179710136 CATTTCCCCTGGAAAGTCCCAGG + Intergenic
918820858 1:189252662-189252684 CATATGGCCTGGGAGGTCTCAGG + Intergenic
920353305 1:205352130-205352152 CAGTCACCCTGAAAGGTCCCAGG + Intronic
920712957 1:208312604-208312626 GATATGCCCTGGAATGTCTCAGG + Intergenic
924451969 1:244186796-244186818 CACTCGCCCTGAAAGAGCTCGGG - Intergenic
924707316 1:246510958-246510980 CCCTTGCCCTGAAAGCTCTGGGG + Intergenic
924809197 1:247386384-247386406 CAGATCCCCTGAAAGATCTCAGG - Intergenic
1062844672 10:695284-695306 CATTTGTCGAGAAAGGTCTGGGG + Intergenic
1065733372 10:28729595-28729617 CCTTTTCCTTGAAAGATCTCTGG + Intergenic
1065880948 10:30037189-30037211 AATTTGCTCTGAAAGCTCTCTGG + Intronic
1067858487 10:49819352-49819374 CCTTTGCCCTGAATGGTCAGCGG + Exonic
1071640192 10:87299233-87299255 CATTTTCCTTGAAAACTCTCAGG - Intergenic
1071655039 10:87438712-87438734 CATTTTCCTTGAAAACTCTCAGG + Intergenic
1073065913 10:100759146-100759168 CAGTGGCCCTGCAAGGTCTTGGG + Intronic
1075998098 10:126894346-126894368 CATCCACCCTGAAAGGTCTGGGG - Intergenic
1080183685 11:29453787-29453809 TATTTTCCCTGAAACTTCTCAGG + Intergenic
1081587882 11:44399745-44399767 CATTTGCCCTGAAGAGTCCCAGG + Intergenic
1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG + Intronic
1082640517 11:55654422-55654444 CCTTTGCCCTAAAAGGTCCTAGG + Intergenic
1084967458 11:72752067-72752089 CCTTTGGCGTGAAGGGTCTCTGG - Intronic
1086051668 11:82599109-82599131 CATTTGCCATCAAAGGACTTTGG + Intergenic
1091164137 11:133456144-133456166 CATTTGCCCCCAAATGTCTATGG - Intronic
1092203936 12:6604340-6604362 AATTAGCCCTAAAATGTCTCTGG + Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1096603521 12:52747635-52747657 CAGTTGCCCTTAAAGATATCGGG + Intergenic
1099474678 12:83094035-83094057 CATTTTCCCTGAATGGTGCCTGG - Intronic
1100673500 12:96841739-96841761 CATTAGTCCTGAAAGACCTCAGG + Intronic
1101079241 12:101165302-101165324 TATTTGCCCTTAAAAGTCTAAGG - Intronic
1101545869 12:105712219-105712241 GATTTGCACTCAAAGCTCTCTGG - Intergenic
1102024794 12:109708334-109708356 CAGATGCCCTGAAAGGGCTCTGG + Intergenic
1103559014 12:121782576-121782598 CACTTGTCCTGAGAGGTGTCTGG - Intronic
1104765316 12:131326361-131326383 CATTTGCATGGAAGGGTCTCAGG + Intergenic
1106920309 13:34556226-34556248 TCTTTGCCCTGAAAGCTCTTTGG + Intergenic
1110529429 13:76578952-76578974 CCTTTGCCCTGAAAGTGCTCTGG - Intergenic
1110993525 13:82074170-82074192 CATGTGCCCATAAAAGTCTCTGG + Intergenic
1112627582 13:101123159-101123181 CATCTGCCTTGGAAAGTCTCTGG + Intronic
1114937911 14:27567189-27567211 CTTTTGCCCTGCAGAGTCTCGGG + Intergenic
1115945030 14:38650217-38650239 CCTTTTCCCTGCAACGTCTCTGG - Intergenic
1116785743 14:49286789-49286811 CATCTACCCTGACAGTTCTCAGG + Intergenic
1119760458 14:77147133-77147155 CCTGTGCCCTGAATGTTCTCTGG - Intronic
1123860321 15:24459479-24459501 AATTTTCTCTGAAATGTCTCTGG + Intergenic
1124594777 15:31083462-31083484 CATGTGCCCTGACAGCTCCCTGG + Intronic
1133401471 16:5490498-5490520 AATTCTCCCTGAAAGGGCTCCGG - Intergenic
1133974796 16:10593019-10593041 GATGTGCCATGAAAGGTCTGGGG - Intergenic
1139363279 16:66416822-66416844 CATGTGCTCTGAAACATCTCTGG - Intergenic
1140102959 16:71934215-71934237 CATTTGACCTCACAGGACTCAGG - Intronic
1140465799 16:75181202-75181224 CATTAGTCCTGAAAGTTTTCTGG - Intergenic
1140962374 16:79928606-79928628 CTTCTGCCCAGAAAAGTCTCAGG - Intergenic
1143157888 17:4850260-4850282 GATTTGGCATGAAAGGTGTCTGG + Intronic
1143835975 17:9693282-9693304 CATATACCCTCAAAGGACTCTGG - Intronic
1145749031 17:27342029-27342051 CATTGGCCCTGAAGGGGCCCTGG - Intergenic
1145817124 17:27803548-27803570 CCTTTAGCCTGAAAGGTCCCAGG + Intronic
1146367514 17:32240447-32240469 CATTTGGCCTGAAAGAATTCAGG + Intronic
1150521938 17:65877550-65877572 AATTTGCCATAAATGGTCTCAGG + Intronic
1152392959 17:80013538-80013560 CACTTGCCCGGCAATGTCTCTGG - Exonic
1153973001 18:10243403-10243425 CATATGCCCTGAAAAACCTCAGG - Intergenic
1155077852 18:22377831-22377853 CAGTTGCCCTGAATGTTCACCGG - Intergenic
1156731522 18:40199132-40199154 CATTTGCAGTGATGGGTCTCTGG - Intergenic
1158480462 18:57817255-57817277 CATTTGCTCTGGAAGGAGTCAGG + Intergenic
1161813145 19:6482069-6482091 CATTTGGCCTGGACGGTCACTGG + Intronic
1162711302 19:12596949-12596971 CAGCTGCCCGGAAAGGGCTCCGG + Intronic
1163460915 19:17436967-17436989 CATTTGCCCTCCAAGCCCTCAGG + Intronic
1167469250 19:49666258-49666280 GATTTGCCCTGAAACCTCTTGGG + Intronic
1167670091 19:50846927-50846949 CATACCCCCAGAAAGGTCTCAGG - Intergenic
1167953436 19:53045839-53045861 CATAGGCCCTCAAAGGACTCTGG - Intronic
926060732 2:9803107-9803129 CATTTGGACTGGAAGGTCTTCGG + Intergenic
931250504 2:60527095-60527117 CACTTGGCCTGAAGGGTCACCGG + Intronic
932290394 2:70572389-70572411 CATTTGGCTAGAAATGTCTCAGG + Intergenic
935280002 2:101508731-101508753 CAGGTGCCCTGAAGGGTCCCAGG - Intergenic
935862249 2:107345668-107345690 CCTTTTCCCTCAAAGGTGTCTGG + Intergenic
936720087 2:115240948-115240970 GGTTTGCCATGAAAAGTCTCTGG - Intronic
937749103 2:125453205-125453227 CATTTGCCCTGTAATATCCCAGG + Intergenic
940403033 2:153268494-153268516 CATGTGCCTGGAAAGGCCTCAGG - Intergenic
943133373 2:183884851-183884873 CAATTACCCTGAAAGCTCTAAGG - Intergenic
944681954 2:202085269-202085291 CCTTTGCCCTGTAACCTCTCAGG - Intronic
946316840 2:218921753-218921775 CATTTTCCCTGAAAGTTTACAGG + Intergenic
948662104 2:239514047-239514069 CATGTTTTCTGAAAGGTCTCGGG - Intergenic
1171107903 20:22453250-22453272 GATTTTCCCTGAAAGTTCTAAGG - Intergenic
1171190651 20:23156842-23156864 CAGTGGCCCTGAAAGGTGTATGG + Intergenic
1171407015 20:24918311-24918333 CATTTTCCCGGAAAGGGCTCAGG + Intergenic
1174442172 20:50564639-50564661 CCTCTGCCCTGAAAGGTTTTTGG + Intronic
1174491598 20:50901736-50901758 CATTTCCCCTAAAAGTGCTCTGG - Intronic
1178386939 21:32160044-32160066 AAATTGCCCTGCAAAGTCTCTGG - Intergenic
1179889267 21:44327492-44327514 CATGTGCCCTGAGAGGCCACAGG + Intergenic
1180132857 21:45837655-45837677 TATTTGCCCTGGTAGGTCTGAGG + Intronic
1181950449 22:26550107-26550129 CATTGACCCTGAAATGTCCCTGG + Intronic
1183833534 22:40433232-40433254 ATTTGGCCCTGAAAGTTCTCTGG - Intronic
952495004 3:33908122-33908144 TGTTTGCCCTGAAAGGTGTTTGG + Intergenic
955598047 3:60613268-60613290 CATGTTCCCAGACAGGTCTCAGG - Intronic
955899070 3:63733206-63733228 CATTTTCCTAGAAAAGTCTCGGG - Intergenic
956765767 3:72483023-72483045 CATTTGTCCTGAAAAGTCGCTGG + Intergenic
958602878 3:96321329-96321351 CATATGCCCAGAAAAGTATCAGG - Intergenic
959608902 3:108271979-108272001 CAGTTGACCTGCAAGTTCTCTGG + Intergenic
964669303 3:159208117-159208139 CTTTCACACTGAAAGGTCTCTGG - Intronic
964794444 3:160481912-160481934 CAGTTGCAATGAAAGGTCTACGG + Intronic
965238632 3:166161727-166161749 CAATTGTCCAGAAAGGCCTCTGG - Intergenic
965394997 3:168152590-168152612 CATTTTCCCTCCTAGGTCTCTGG - Intergenic
966839330 3:184076146-184076168 CATTTTCTCTGAAAGGTACCTGG + Intergenic
967315649 3:188149991-188150013 CATTTGGCCTGATAGGTTTTAGG + Intergenic
968229499 3:196997003-196997025 CAGCTGCCCTGAAACTTCTCAGG + Intronic
971262100 4:25066505-25066527 CATTTTCCCTGGGAGGTATCTGG - Intergenic
975662819 4:76704653-76704675 TACTTGGCCTGCAAGGTCTCTGG - Intronic
983910858 4:173237160-173237182 CATCTGCCCTGAAAGCTTTGAGG + Intronic
985276872 4:188245834-188245856 CTTTTGTCCTGACAGGTCTCAGG - Intergenic
994655629 5:102590129-102590151 CATTTGACCCATAAGGTCTCTGG - Intergenic
995269780 5:110207074-110207096 CATTTGACCTGGAAGTTTTCTGG + Intergenic
995358327 5:111264931-111264953 CATTTGTACTGAAAGGTCAACGG - Intronic
998038253 5:138934549-138934571 CATGTTCCCAGAAAGGTCTCTGG + Exonic
1002442628 5:179272356-179272378 CATGTGCCCTACAAGGACTCTGG - Intronic
1002924489 6:1597149-1597171 CATTTGCCCTGGAGGCTCACAGG + Intergenic
1004413373 6:15402109-15402131 CCTTTGCCCTGAAACCTCTCTGG - Intronic
1006297593 6:33176891-33176913 CCCTTGCACTGAAAGGTCACTGG - Intronic
1007114803 6:39335883-39335905 CATCTGCCCTGCAGGGTCTAAGG - Exonic
1007205172 6:40144078-40144100 CATGGTCCATGAAAGGTCTCTGG - Intergenic
1007721997 6:43890663-43890685 CATTAGCCCTGAAAACCCTCCGG - Intergenic
1007992992 6:46276741-46276763 AAATTGCTCTGAAAGCTCTCTGG + Intronic
1010053933 6:71541647-71541669 CTTTTGGCCTGAAAAGTTTCAGG - Intergenic
1011208912 6:84933383-84933405 CATTTGCCCAGAGAGCTATCAGG + Intergenic
1013985870 6:116192904-116192926 CAGTTGTCCTGACTGGTCTCTGG + Intronic
1022314155 7:29229022-29229044 CTTTCACCCTGAAAGCTCTCTGG + Intronic
1023463046 7:40421375-40421397 CATTTGCACTGAGAGGACTCAGG + Intronic
1029607623 7:101608665-101608687 CCTCTGCCCTCAATGGTCTCTGG - Intergenic
1033433647 7:141312532-141312554 CAATGGCCCTGAGAGGTCTTTGG + Intronic
1044144759 8:88698324-88698346 AATTTGCCCTGTAAGGCTTCAGG + Intergenic
1046021455 8:108670346-108670368 GATTTGCCCTGCAATGTCTTTGG + Intronic
1046657118 8:116906893-116906915 CATATTCCCAGAAAAGTCTCAGG + Intergenic
1048524990 8:135194331-135194353 CTTTTGCCCTGAATGATATCTGG - Intergenic
1049534539 8:143172252-143172274 CATTTGCTCTGAAGGGTCTCGGG - Intergenic
1050297178 9:4217299-4217321 CATTTGCCCTAAAAGCACTGTGG + Intronic
1051871934 9:21747955-21747977 CATTTAACCAGAATGGTCTCTGG - Intergenic
1053944882 9:43296579-43296601 CATGTGCGCTGTGAGGTCTCTGG + Intergenic
1055993554 9:82132858-82132880 CATTTGCACTGGTTGGTCTCAGG + Intergenic
1056658925 9:88530803-88530825 CCTTTGCCCCACAAGGTCTCAGG - Intergenic
1057985370 9:99708108-99708130 CATTTGTCCTGCAATATCTCCGG - Intergenic
1061513778 9:131076706-131076728 CTTTTGCCCTGACAGGCCTGTGG - Intronic
1062259138 9:135650053-135650075 CATGTGAGCTGAAAGGCCTCTGG - Intergenic
1203588017 Un_KI270747v1:25157-25179 CATGTGCGCTGTGAGGTCTCTGG + Intergenic
1187058933 X:15767330-15767352 TATTTACCCTGAAAGTTCTTGGG - Intronic
1188787949 X:34371967-34371989 TATCAGTCCTGAAAGGTCTCTGG - Intergenic
1189145329 X:38649646-38649668 CCTTTGCCCTGAACGGACCCTGG - Intronic
1189381048 X:40502410-40502432 GATTTGCACTGAAATCTCTCTGG + Intergenic
1192479540 X:71473108-71473130 CATTTGCCCTCAAGTGTCACAGG + Intronic
1195550174 X:106160207-106160229 CATTTGCCCAGAGATTTCTCAGG + Intergenic
1196273853 X:113743209-113743231 CATAGACCTTGAAAGGTCTCTGG - Intergenic
1199447678 X:147944775-147944797 GATTACCCCTGAAACGTCTCTGG + Intronic
1202082344 Y:21096919-21096941 TATTTGTTCTTAAAGGTCTCTGG - Intergenic