ID: 1081620852

View in Genome Browser
Species Human (GRCh38)
Location 11:44618533-44618555
Sequence AGCCCGGAAGCCCCTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620852_1081620869 18 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620869 11:44618574-44618596 GTGGTTCTGCATGGCGGGGTGGG 0: 1
1: 0
2: 1
3: 28
4: 344
1081620852_1081620864 9 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620864 11:44618565-44618587 GGGCTCTCGGTGGTTCTGCATGG 0: 1
1: 0
2: 0
3: 14
4: 124
1081620852_1081620862 -4 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620862 11:44618552-44618574 GGCTGGGACTGGGGGGCTCTCGG 0: 1
1: 0
2: 5
3: 67
4: 597
1081620852_1081620865 12 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620865 11:44618568-44618590 CTCTCGGTGGTTCTGCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1081620852_1081620870 22 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620870 11:44618578-44618600 TTCTGCATGGCGGGGTGGGATGG 0: 1
1: 0
2: 1
3: 36
4: 249
1081620852_1081620868 17 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620868 11:44618573-44618595 GGTGGTTCTGCATGGCGGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 188
1081620852_1081620867 14 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620867 11:44618570-44618592 CTCGGTGGTTCTGCATGGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 93
1081620852_1081620863 -1 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620863 11:44618555-44618577 TGGGACTGGGGGGCTCTCGGTGG 0: 1
1: 1
2: 0
3: 22
4: 283
1081620852_1081620866 13 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620866 11:44618569-44618591 TCTCGGTGGTTCTGCATGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620852 Original CRISPR AGCCCGGAAGCCCCTACAGA GGG (reversed) Intronic
902955516 1:19922214-19922236 AGACAGGAAGCCCCTCCTGATGG - Intronic
903720561 1:25402523-25402545 ACCCCGGAAGCCCCACCAAATGG + Intronic
904602818 1:31683235-31683257 GTCCCGGAAGTCCCTGCAGATGG + Exonic
906062511 1:42958117-42958139 AGCCCGGACGCCCCTGTAGGTGG - Intronic
908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG + Intergenic
920627249 1:207614105-207614127 AGCCCAGCATCACCTACAGAAGG - Intronic
920637195 1:207715020-207715042 AGCCCAGCATCACCTACAGAAGG - Intronic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG + Intergenic
1068906031 10:62323813-62323835 AGCCCGAAAGCTCCTTCAGCTGG + Intergenic
1073327145 10:102649664-102649686 AGCCCGGCAGACCCCAGAGAGGG - Intronic
1077889766 11:6410755-6410777 AGGCCCCAAGCCCTTACAGATGG - Exonic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG + Intronic
1091389576 12:117844-117866 AGGCCAGAAGCCCCTGCAGGAGG - Intronic
1091782766 12:3224445-3224467 AGCTAGGAAGAACCTACAGAAGG + Intronic
1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG + Intronic
1092100046 12:5875549-5875571 AGCCTGGAAGCTCCCACAGATGG - Intronic
1092199345 12:6570440-6570462 AGCCCGCCAGCTCCTGCAGATGG + Exonic
1102490352 12:113286727-113286749 TGCCCGGGAACCCCTACAAAGGG - Intronic
1113804566 13:113105871-113105893 AGCCCTGAAGCCCAAGCAGAAGG - Exonic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1119288651 14:73476608-73476630 AGCCAGCAAGACCATACAGAGGG - Intergenic
1122891274 14:104733320-104733342 AGCCCTGAAGCCCCTTCGCAGGG - Intronic
1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG + Intergenic
1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG + Intronic
1130443576 15:83978422-83978444 AGCCCAGCAGCCCCTTCAGGAGG + Intronic
1132140651 15:99390833-99390855 AGCCTGGAAGCCACTAGAGGGGG + Intergenic
1132852906 16:2032887-2032909 AGCCCCCAAGGCCCTCCAGATGG - Intronic
1136672903 16:31874032-31874054 GGCCCGGGTGCCCCTACAGCGGG - Intronic
1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG + Intronic
1137727257 16:50665285-50665307 AGCCCAGAAGCCCCAAAAGGCGG - Intergenic
1140665792 16:77226048-77226070 TGCCCGGAATCCCTTTCAGAAGG + Intergenic
1142218827 16:88842864-88842886 AGGCCAGAAGCACCTGCAGAAGG - Intronic
1142795473 17:2303769-2303791 AGCCAGGAAACCACCACAGACGG + Exonic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1148086703 17:44997953-44997975 AGCCCAGAGGCCCCTGCAGGGGG + Intergenic
1149015828 17:51907360-51907382 AGCCGGGAAGGCCCCACTGAAGG - Intronic
1155909050 18:31487463-31487485 GGCCTGGAGGCCCCAACAGAAGG - Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1162614222 19:11784287-11784309 AGCCTGGAAGTCACTTCAGATGG + Intergenic
1163670780 19:18627172-18627194 AGGCCGGAAGCCCCAAGAGGAGG - Intergenic
1165079220 19:33298253-33298275 TCCCGGGAAGCCCCTACAGCTGG + Intergenic
925064918 2:922278-922300 AGCCCGGAAGCACCTTCCGGAGG - Intergenic
925387746 2:3474051-3474073 GGCACGGAAGCCATTACAGATGG - Intronic
927055438 2:19361771-19361793 AGCCCGGAAGCCCGGGCAGACGG - Intergenic
929580438 2:43078838-43078860 AGCCCTGAAGCTCCTAAGGAGGG + Intergenic
933514486 2:83283516-83283538 AGCCCGGAAGCCCCTGCTTTGGG + Intergenic
937284055 2:120738805-120738827 AGCCCGGAAGTCTCTGCTGAAGG - Intronic
937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG + Intronic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
948998555 2:241597688-241597710 AGCCAGGAAGCACACACAGAAGG - Intronic
1174744616 20:53049092-53049114 TGCCCAGAAGCCCTTACAAAGGG + Intronic
1175402209 20:58707219-58707241 ACCCAGGATGCCCCTGCAGAGGG - Intronic
1175402447 20:58708286-58708308 AGCTGGGAAGCCCCGGCAGAAGG - Intronic
1179800576 21:43809901-43809923 AGCCCGGAAGTTCCCCCAGAGGG + Intergenic
1181428339 22:22858460-22858482 ATCCAGGAAGGCTCTACAGAGGG + Intronic
950196883 3:11015597-11015619 AGGCAGGCAGCTCCTACAGAGGG - Intronic
954878829 3:53820510-53820532 AGCACAGAAGCCCCTGCGGAAGG - Exonic
955470306 3:59279689-59279711 AGCCCGGAAGCAAGTAGAGAAGG - Intergenic
960615978 3:119596403-119596425 AGCCAGGAAGCGCCTTTAGATGG - Intergenic
961346872 3:126268658-126268680 AGCAGGGCAGCCCCTGCAGAGGG + Intergenic
961516756 3:127442791-127442813 AGCCAGGAAGCCCCCAGGGAGGG - Intergenic
965402669 3:168231623-168231645 GGCCAGGAAGCCCCTAAACATGG - Intergenic
967341887 3:188407672-188407694 AGCCCTGAAGTCACTAAAGAAGG - Intronic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
985721063 5:1489318-1489340 AGCCAGGCTGCCCCTACAGCTGG + Intronic
985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG + Intergenic
999122017 5:149217061-149217083 AGGTCGGAAGGCCTTACAGAGGG - Intronic
1002425313 5:179171513-179171535 AGCCCAGAACCCCCCAGAGAAGG + Intronic
1003772449 6:9321224-9321246 ATCTCGGAAGCCCATACAAAAGG - Intergenic
1011185191 6:84667346-84667368 AGCCCGGTAGCCCCAAAAGATGG + Intergenic
1012672952 6:102078849-102078871 AGCCCTTAATGCCCTACAGATGG + Intergenic
1017979298 6:159385571-159385593 AGCCCAGAAGCAACTGCAGAGGG - Intergenic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1020849789 7:13337782-13337804 AGCCAGGATCCCCCTACAGCTGG - Intergenic
1031423817 7:121581790-121581812 AGCTAGGGAGCCCCTAGAGATGG + Intergenic
1032276354 7:130459546-130459568 AGCCCGGCAGCCACCAGAGAGGG - Intergenic
1033947564 7:146740750-146740772 AGCCTGGAACCCACTACAGCAGG + Intronic
1034468944 7:151245629-151245651 AGCCCGGATGCCCCACCAGGGGG - Exonic
1036812952 8:11880179-11880201 GTCCCTGAAGCCCCTTCAGAGGG - Intergenic
1040905153 8:52461422-52461444 ACTCCGGCAGCCCCTGCAGAAGG - Intergenic
1048899266 8:139022172-139022194 AGCCCAGAGGCTCCTGCAGAGGG - Intergenic
1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG + Intronic
1061241906 9:129379262-129379284 ATTCCGGCAGCCCCCACAGATGG + Intergenic
1190279339 X:48918959-48918981 GGCCCGGAAGCGCCCGCAGACGG + Exonic