ID: 1081620853

View in Genome Browser
Species Human (GRCh38)
Location 11:44618534-44618556
Sequence CAGCCCGGAAGCCCCTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620853_1081620868 16 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620868 11:44618573-44618595 GGTGGTTCTGCATGGCGGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 188
1081620853_1081620867 13 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620867 11:44618570-44618592 CTCGGTGGTTCTGCATGGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 93
1081620853_1081620866 12 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620866 11:44618569-44618591 TCTCGGTGGTTCTGCATGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1081620853_1081620862 -5 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620862 11:44618552-44618574 GGCTGGGACTGGGGGGCTCTCGG 0: 1
1: 0
2: 5
3: 67
4: 597
1081620853_1081620864 8 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620864 11:44618565-44618587 GGGCTCTCGGTGGTTCTGCATGG 0: 1
1: 0
2: 0
3: 14
4: 124
1081620853_1081620869 17 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620869 11:44618574-44618596 GTGGTTCTGCATGGCGGGGTGGG 0: 1
1: 0
2: 1
3: 28
4: 344
1081620853_1081620863 -2 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620863 11:44618555-44618577 TGGGACTGGGGGGCTCTCGGTGG 0: 1
1: 1
2: 0
3: 22
4: 283
1081620853_1081620870 21 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620870 11:44618578-44618600 TTCTGCATGGCGGGGTGGGATGG 0: 1
1: 0
2: 1
3: 36
4: 249
1081620853_1081620865 11 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620865 11:44618568-44618590 CTCTCGGTGGTTCTGCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620853 Original CRISPR CAGCCCGGAAGCCCCTACAG AGG (reversed) Intronic
900409273 1:2505401-2505423 CAGCCTCGAAGCCCCTCCTGTGG - Exonic
902472298 1:16657289-16657311 CAGCCTGCCACCCCCTACAGAGG - Intergenic
902486505 1:16750157-16750179 CAGCCTGCCACCCCCTACAGAGG + Intronic
906120972 1:43390123-43390145 CAGCCCGGAAGGCCCGACTATGG + Intronic
911351590 1:96762328-96762350 CTGCCCGGCTGCCCCTACTGGGG - Intronic
913699650 1:121362136-121362158 CAGCACGGAAGCCCTTCCTGGGG + Intronic
914137894 1:144917900-144917922 CAGCACGGAAGCCCTTCCTGGGG - Intronic
920487058 1:206380845-206380867 CAGCACGGAAGCCCTTCCTGGGG + Intronic
921554657 1:216583540-216583562 CAGCCATGAAGCCCCTGTAGAGG - Intronic
921650705 1:217674636-217674658 CAGCCCCGAAGCCCCAGAAGGGG + Intronic
922575567 1:226658870-226658892 CAGACCGGGACCCCCTGCAGGGG + Intronic
922890595 1:229058814-229058836 CAGCCCGGAAGACACTGCAGCGG - Intergenic
1076007440 10:126959031-126959053 CAGCCTGGAAGCCCCTGCTTTGG - Intronic
1076680438 10:132168837-132168859 CAGCCTGGAAGCCCCTGCACGGG + Exonic
1076816366 10:132916944-132916966 CAGCCCCGAAGGACCAACAGTGG + Intronic
1077402864 11:2367647-2367669 CAGCCAGGCAGCCCCTCCAATGG + Intergenic
1077540513 11:3144516-3144538 CAGCCCGCACTCCCCTGCAGAGG - Intronic
1077869676 11:6251273-6251295 CAACCTGGAAGCCCCGCCAGAGG - Intergenic
1078139651 11:8682903-8682925 CAGCCTGGAAGCCCCGACCATGG - Intronic
1078433307 11:11303925-11303947 CAGCCAGGCAGCCCCTCCAAGGG - Intronic
1081620853 11:44618534-44618556 CAGCCCGGAAGCCCCTACAGAGG - Intronic
1081772692 11:45659496-45659518 CAGCCCTCAAGCCCCACCAGTGG - Intronic
1083639125 11:64135921-64135943 CAGCCGGGAAGCTGCTCCAGGGG - Intronic
1084472803 11:69373069-69373091 CAGCCTGGAAGGCCATACCGGGG - Intergenic
1084512779 11:69616498-69616520 CAGCCCGGAGGCCCCCACACAGG + Intergenic
1090390495 11:126384379-126384401 CAGCCCTGGAGTCCCTACACAGG - Intronic
1100435356 12:94566087-94566109 CAGTCGGGAAGCGTCTACAGGGG - Intergenic
1101405553 12:104425687-104425709 CAGCACAGAAGTCCCTTCAGAGG + Intergenic
1104633616 12:130424647-130424669 AGGCCCGGCAGGCCCTACAGGGG - Intronic
1105027336 12:132857638-132857660 CACCACGGAAGGGCCTACAGGGG + Intronic
1106792644 13:33171222-33171244 CAGCCCTGGAGCTGCTACAGGGG - Intronic
1107561199 13:41558995-41559017 CAGCCCAGAGGCCACCACAGTGG + Intergenic
1108493426 13:51002712-51002734 CTGCCTGGAAGCCCCTACCCAGG + Intergenic
1113568332 13:111334877-111334899 CAGCCTGGCAGCCACTGCAGCGG - Intronic
1113710185 13:112457960-112457982 CATCCCGGAAGCTCCTCGAGTGG - Intergenic
1114007739 14:18332729-18332751 CAGCCCTGCAGCCTCTACTGTGG + Intergenic
1114314006 14:21493182-21493204 CAGCCCTGAGGCCCATACAGTGG + Exonic
1119288652 14:73476609-73476631 CAGCCAGCAAGACCATACAGAGG - Intergenic
1119420210 14:74503734-74503756 CAGCCTGGAAGGCCCTCCTGGGG + Intronic
1121045681 14:90785975-90785997 TGGCCCAGAAGCCCCCACAGTGG + Intronic
1122913344 14:104844374-104844396 CAGCCCGGCAGCCCCCAGACAGG + Intergenic
1122992108 14:105241320-105241342 CTGCCCTGAGGCTCCTACAGAGG - Exonic
1123995595 15:25715949-25715971 CACCCCAGAAAGCCCTACAGTGG - Intronic
1125334533 15:38614463-38614485 CAGGCTGGAAGCCCATAGAGGGG - Intergenic
1129503407 15:76060574-76060596 CAGGCCAGAATCCCCTTCAGGGG + Intronic
1132140650 15:99390832-99390854 CAGCCTGGAAGCCACTAGAGGGG + Intergenic
1132615849 16:840788-840810 CCCCCCAGAAGCCCCCACAGTGG - Intergenic
1132747171 16:1441635-1441657 CAGCCCCGAAGCCCCTTCCACGG - Intronic
1135347943 16:21705259-21705281 CAGCCTGGAAGCCCCTCAGGTGG - Exonic
1136672904 16:31874033-31874055 AGGCCCGGGTGCCCCTACAGCGG - Intronic
1140518990 16:75566229-75566251 CAGCCCAGGAGCCCCCAAAGGGG + Intergenic
1140909377 16:79437921-79437943 CAGGCCAGCAGCCCCTGCAGAGG - Intergenic
1141836739 16:86545606-86545628 CAGCCCTGAGGCCGCTACTGAGG + Intronic
1143366530 17:6412444-6412466 CAGCCCCCAATCTCCTACAGGGG + Intronic
1143491772 17:7289337-7289359 CCACCAGGAAGCCCCCACAGAGG - Intronic
1145911805 17:28547461-28547483 CAGTCCTGAAGCCCCTGCAGTGG - Intronic
1147122467 17:38343737-38343759 CAGCCCAGCAGCCCCCACATAGG + Exonic
1148086702 17:44997952-44997974 CAGCCCAGAGGCCCCTGCAGGGG + Intergenic
1151755756 17:76074551-76074573 CAGCCCAGAACCCCCGACTGCGG + Intronic
1152703796 17:81832895-81832917 CAGCCCCAAAGCCCCGACGGCGG + Intronic
1156463936 18:37336897-37336919 CAGCCCGGCAGCCCCGCCGGGGG - Intronic
1158512752 18:58106151-58106173 CAGCACGGATGTCCCTACACAGG - Intronic
1161313618 19:3607835-3607857 CAGTCCGGAAGCCCCTTCCCCGG + Intergenic
1202704695 1_KI270713v1_random:14083-14105 CAGCCTGCCACCCCCTACAGAGG - Intergenic
927085723 2:19672572-19672594 GAGCCCGTCAGCCCCCACAGGGG + Intergenic
929580437 2:43078837-43078859 CAGCCCTGAAGCTCCTAAGGAGG + Intergenic
931169243 2:59785394-59785416 CAGTCTGGGACCCCCTACAGTGG - Intergenic
933514485 2:83283515-83283537 CAGCCCGGAAGCCCCTGCTTTGG + Intergenic
936289087 2:111205310-111205332 CATCCCTGAAGACCCTCCAGTGG + Intergenic
938528817 2:132162674-132162696 CAGCCCTGCAGCCTCTACCGTGG - Intronic
940247355 2:151634103-151634125 CATCCTGGAAGCCCTTACAGAGG + Intronic
941657517 2:168159890-168159912 CAGGCAGGAAGCCCCTGCACAGG - Intronic
948308717 2:236969287-236969309 CAGCACCGCAGCCCCTCCAGAGG + Intergenic
948951278 2:241253440-241253462 CACCCTGGAGGGCCCTACAGAGG - Exonic
1169122864 20:3107752-3107774 CAGCCTGGGAGCCCCTGGAGTGG - Exonic
1173719804 20:45246324-45246346 CAGCCCAGCAGCCCCTGCACGGG - Intergenic
1174384129 20:50176588-50176610 CAGGCCGGTAACCCCCACAGAGG - Intergenic
1174404133 20:50292808-50292830 CAGCCCCCAAGCCCCGCCAGCGG + Intergenic
1175402210 20:58707220-58707242 CACCCAGGATGCCCCTGCAGAGG - Intronic
1175996226 20:62813367-62813389 CAGCCCGGCAGGACCTACAAGGG + Exonic
1175996287 20:62813547-62813569 CAGCCCGGCAGGACCTACAAGGG + Exonic
1176145076 20:63561894-63561916 CAGCCCGGAGGCCCCCCCCGTGG - Exonic
1176767689 21:13037238-13037260 CAGCCCTGCAGCCTCTACCGTGG + Intergenic
1178026758 21:28477369-28477391 CAACCCTGAAGCCACTACTGAGG + Intergenic
1180432244 22:15263539-15263561 CAGCCCTGCAGCCTCTACTGTGG + Intergenic
1181110368 22:20599186-20599208 AAGCCAGGAAGACCCAACAGTGG + Intergenic
1181428338 22:22858459-22858481 CATCCAGGAAGGCTCTACAGAGG + Intronic
1185158777 22:49210044-49210066 CAGCCGGGCAGCCCCTGGAGGGG + Intergenic
950196884 3:11015598-11015620 CAGGCAGGCAGCTCCTACAGAGG - Intronic
960753164 3:120979198-120979220 CAGCCGGGAAGCTCCAACTGGGG - Intronic
961346871 3:126268657-126268679 CAGCAGGGCAGCCCCTGCAGAGG + Intergenic
968626216 4:1627802-1627824 CAGCAGGGCAGCCCCTCCAGAGG + Intronic
975685817 4:76917408-76917430 CTGCCCGGCCGCCCCTACTGGGG + Intergenic
981067222 4:140498074-140498096 CAGCCCCGAAGCCCCCGCGGCGG + Intronic
984511706 4:180686344-180686366 CATCCAGGAATCCCCTTCAGTGG - Intergenic
988993045 5:36690142-36690164 CAGCCCCGCAGCCCCTGCGGCGG - Intergenic
998025184 5:138810852-138810874 CTGCCCGGCCGCCCCTACTGGGG - Intronic
999122018 5:149217062-149217084 CAGGTCGGAAGGCCTTACAGAGG - Intronic
1000158648 5:158577518-158577540 CAGCCGGGAAGCTCCAACTGGGG - Intergenic
1001003227 5:168027344-168027366 CTGCCCAGAAGCCCCTAGAATGG + Intronic
1001378839 5:171288837-171288859 CAACCTGCAAGCCCCTACAAAGG + Intronic
1004976253 6:20970203-20970225 CAGCCTGGAAGCCACTTGAGGGG - Intronic
1013793721 6:113860543-113860565 CAGTCCAGAAGCCCCCCCAGCGG + Exonic
1016843256 6:148544905-148544927 CAGCCCGGTAGCCCGCCCAGTGG + Intronic
1017774791 6:157672563-157672585 CAGGCAGGGAGCGCCTACAGTGG - Intronic
1017979299 6:159385572-159385594 CAGCCCAGAAGCAACTGCAGAGG - Intergenic
1018952326 6:168387322-168387344 CAGCCCTGGAGCCCTGACAGGGG - Intergenic
1019481840 7:1270488-1270510 CAGCCCGGATGCCACTGGAGTGG - Intergenic
1019910687 7:4099072-4099094 CAGCCAGGAAGGCTCTGCAGAGG + Intronic
1023017311 7:35981305-35981327 CATCCAGGAAACCCATACAGAGG - Intergenic
1027600974 7:80240808-80240830 AAGCCTGGAAGACCCTAGAGCGG + Intergenic
1032086817 7:128888814-128888836 CACCCCGGGAGCCCCAGCAGGGG + Intronic
1032276355 7:130459547-130459569 CAGCCCGGCAGCCACCAGAGAGG - Intergenic
1034468945 7:151245630-151245652 GAGCCCGGATGCCCCACCAGGGG - Exonic
1035199115 7:157248797-157248819 CTGCCCGGCAGCCCCTCCTGCGG + Intronic
1037817575 8:22120208-22120230 CAGCCCTGAAGCCCCTGCCCCGG + Intronic
1038963492 8:32548056-32548078 CTGCCGGGAACCCCCGACAGGGG - Intronic
1045343537 8:101274586-101274608 CAACACAGAAGCCTCTACAGTGG - Intergenic
1048878080 8:138852259-138852281 CAGCCAGGAGGCCACCACAGTGG + Intronic
1053503188 9:38620003-38620025 CAGCCCGGCAGCCCCTGGGGCGG - Intergenic
1055702183 9:78957361-78957383 CTGCCCAGAACCCCCTTCAGTGG + Intergenic
1058795921 9:108498260-108498282 CAGCCAGGAAGCTCCAACTGGGG + Intergenic
1059453738 9:114387037-114387059 CAGCCAGGAAGCGCAGACAGAGG + Intronic
1062538066 9:137029479-137029501 CAGCCAGGGAGCCCCTGTAGTGG - Intronic
1189234540 X:39477251-39477273 TAGCCCGGAAGCCTCTCCAAAGG - Intergenic
1195065881 X:101237714-101237736 CAGCTCAGCTGCCCCTACAGGGG + Exonic