ID: 1081620862

View in Genome Browser
Species Human (GRCh38)
Location 11:44618552-44618574
Sequence GGCTGGGACTGGGGGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 597}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620853_1081620862 -5 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620862 11:44618552-44618574 GGCTGGGACTGGGGGGCTCTCGG 0: 1
1: 0
2: 5
3: 67
4: 597
1081620852_1081620862 -4 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620862 11:44618552-44618574 GGCTGGGACTGGGGGGCTCTCGG 0: 1
1: 0
2: 5
3: 67
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620862 Original CRISPR GGCTGGGACTGGGGGGCTCT CGG Intronic
900080257 1:851457-851479 AGCTGGGACTGGAGGACCCTGGG - Intergenic
900475741 1:2875616-2875638 GGCCTGGCCTGGGGTGCTCTTGG + Intergenic
900520231 1:3101865-3101887 AGCTGGGACTGGGGGTCTCCGGG - Intronic
900564892 1:3327405-3327427 GGCGGGGGCTGAGGGGCTGTTGG - Intronic
900695123 1:4004917-4004939 GGCTGGGAGCGGTGGGCTCACGG + Intergenic
900964541 1:5948629-5948651 CTCTGGGAAAGGGGGGCTCTGGG - Intronic
901536253 1:9884407-9884429 GCCTGGGGCTGGGCAGCTCTCGG - Intronic
902044282 1:13513573-13513595 GGCTGGGGCTCGGGGGCGCATGG + Exonic
902870810 1:19312513-19312535 GGCCGGGACTGGGTGGCCCTCGG + Exonic
903260357 1:22128560-22128582 GGCTGGGGCTGGGATGCTCAGGG - Intronic
903380213 1:22891496-22891518 GGCTGGGACTGGGGTTCTACAGG - Intronic
903690212 1:25167952-25167974 GGCTGGAACTGAGAGGCTCACGG + Intergenic
903709183 1:25309688-25309710 GGCTTGGACTGGGTGGCTCTTGG - Intronic
903717929 1:25382731-25382753 GGCTCGGAATGAGTGGCTCTTGG + Intronic
903951786 1:26999786-26999808 GGGTGGGGCTGGGTGGCTGTGGG + Intronic
904037149 1:27565026-27565048 GGCTGGAGCTGGGGGGCCCTGGG + Intronic
904462245 1:30686978-30687000 GGCTGGGTCTGGGGGCTTCCAGG + Intergenic
904604636 1:31691821-31691843 GGCTGGGAGTGAGGGGGCCTGGG + Intronic
905033890 1:34904885-34904907 GGCTCTCACTGCGGGGCTCTGGG + Exonic
905279384 1:36839222-36839244 GGCTTGGAGTCTGGGGCTCTGGG - Intronic
905409324 1:37757402-37757424 GGCTGGCAGTGGGGAGCTGTTGG - Intronic
905851183 1:41276224-41276246 GGCTGGAACCAGGGAGCTCTGGG - Intergenic
905858030 1:41327756-41327778 GACTGGTACTGGGGGGAGCTAGG + Intergenic
907243505 1:53093291-53093313 GGCTGGGGCTGGGGGACCCATGG + Intronic
907966071 1:59331120-59331142 GGCTGAGACTGAGAGGCTTTAGG + Intronic
908128171 1:61050616-61050638 GGCGGGGACTGCGGCGCTCGCGG - Intronic
908258225 1:62319401-62319423 GGCGGGGACTCGGGCGCTGTTGG - Exonic
908935939 1:69375377-69375399 GGCTTGGAGTGGAGGGCACTTGG - Intergenic
909808076 1:79896160-79896182 GGCTGGGATCAGGGGGCTTTAGG - Intergenic
911597750 1:99816178-99816200 GCCTGGGACTGTGGGGCTTGAGG - Intergenic
912449809 1:109761855-109761877 TGCTCTGACTGGGGGCCTCTGGG + Intronic
913303661 1:117399998-117400020 GGCTGGGATTGGAAGACTCTTGG + Intronic
913523175 1:119665622-119665644 GCTTGGGACTGAGGGGCTCGTGG + Intronic
914421253 1:147530190-147530212 GGCTGGGGCTGTGTGGATCTGGG - Intergenic
915317052 1:155034532-155034554 GGCAGGCGCTGGGGGGCTCCTGG + Exonic
915347503 1:155205194-155205216 GGCTGGGTCTGGAGGGACCTCGG + Exonic
915540631 1:156563699-156563721 GGCAGGGTCTTGGGGGTTCTGGG - Intronic
915808198 1:158876943-158876965 AGCTGGTACTGGGCTGCTCTGGG + Intergenic
915915348 1:159937377-159937399 GGGTGGGAGAGAGGGGCTCTTGG - Intronic
915954362 1:160210100-160210122 GGCTGGGAATGGGGACTTCTGGG + Intronic
916127107 1:161581393-161581415 GGCTGTGACTGCTGTGCTCTGGG + Intronic
916137027 1:161663197-161663219 GGCTGTGACTGCTGTGCTCTGGG + Exonic
917960744 1:180142425-180142447 AGCAGGGACTGAGGTGCTCTGGG + Intergenic
918044921 1:180935846-180935868 GACTGCGACTGCGGGGCTCCAGG + Exonic
919910262 1:202106752-202106774 GGCGGGGCCTGGGCTGCTCTAGG - Intergenic
920061442 1:203229571-203229593 GGCTGGGTCTCGGGAGCTGTGGG - Intronic
920255477 1:204651603-204651625 GCCTGGGGCTGGGGGGTTTTGGG - Intronic
920665584 1:207960419-207960441 GTCTGGGACTGGGGACCCCTGGG + Intergenic
921066525 1:211626815-211626837 GGCTGGGACTAGGGCTCCCTTGG - Intergenic
922057004 1:222050964-222050986 GTCTGGAACTGGTGGGTTCTTGG - Intergenic
922214075 1:223506769-223506791 GTCAGAGACTGGGAGGCTCTGGG + Intergenic
922774704 1:228209282-228209304 TGCAGGGTCTGGGGGGCTCATGG - Intronic
922790002 1:228306120-228306142 GGCTGGGTGGGGGGGGCCCTGGG + Intronic
923010585 1:230084585-230084607 GGCTGAGACTGGTGGGCTCGGGG + Intronic
923835175 1:237603328-237603350 TGCTGGGACAGGGGGGCACCAGG - Intronic
1062831386 10:608252-608274 GGCTGTGTGTGGGGGGCTGTGGG - Intronic
1063116518 10:3075604-3075626 GGCCGGGAGTGGGGGACTCTGGG + Intronic
1063378060 10:5565942-5565964 GGCTGGGAAGGGGTGGCTCAGGG + Intergenic
1064109984 10:12530257-12530279 GGCTGCGAGTGGGGGGCCCTAGG + Intronic
1065133010 10:22641738-22641760 GGCCGGGCATGGGGGGCTCATGG - Intronic
1066346407 10:34591089-34591111 GACTGGGACTGGGGCCCTCTGGG - Intronic
1066484292 10:35828522-35828544 CCCTAGGGCTGGGGGGCTCTTGG + Intergenic
1066988728 10:42492168-42492190 GGCTGCAACTGGGGGGTCCTTGG - Intergenic
1067060928 10:43077533-43077555 GGCCGGGGCTGGGCGGGTCTCGG + Intronic
1067436846 10:46284640-46284662 GGCGGGGCCTGGTGGCCTCTGGG - Intergenic
1067528241 10:47051253-47051275 GGCCGGGACTGAGGGGCTGCTGG + Intergenic
1067674453 10:48359598-48359620 GGCAGGGAATGGGTGGTTCTGGG - Intronic
1067768759 10:49108783-49108805 GGCTGGGAGTGGGCAGCCCTCGG - Intronic
1067831883 10:49615157-49615179 GGGGGGGAGGGGGGGGCTCTGGG + Intronic
1069438443 10:68407021-68407043 GCCTGGGACTCGGGGGCTCCCGG - Exonic
1069534273 10:69241433-69241455 GGAAGGCACTGGGGGACTCTGGG + Intronic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1069571750 10:69498411-69498433 TGTGGGGACTGGGGGGCTGTCGG + Intronic
1069622804 10:69848124-69848146 AGCTGAGACTGAGGGGCTCTGGG + Intronic
1069772883 10:70910704-70910726 GGCTGAGGCTGGGGAGATCTGGG + Intergenic
1069812595 10:71173442-71173464 GGCTGTGACTTTGGGCCTCTTGG - Intergenic
1069840218 10:71335231-71335253 GGAAGGTACTGGGGAGCTCTGGG - Intronic
1069984460 10:72273960-72273982 GGACGGGTCTGGGCGGCTCTCGG + Exonic
1070158860 10:73853390-73853412 GCCTTGCACTGGGGGGCACTGGG - Intronic
1070383848 10:75906034-75906056 AGCTGGGACTGGGAGCATCTAGG - Intronic
1070717523 10:78733370-78733392 GGCTGGGATTGGGAAGCCCTGGG - Intergenic
1070754242 10:78981823-78981845 GCCTGGGGCTGGGGGACTCCTGG - Intergenic
1071332416 10:84573128-84573150 TGCTGGGACTGAGGGGATCCTGG - Intergenic
1071797894 10:89025652-89025674 GGCTGGGCCTGTGGAGCCCTGGG - Intergenic
1072726135 10:97815314-97815336 GGCTGGGGATGGGGTGCCCTGGG + Intergenic
1073328948 10:102658510-102658532 GGCTGGGCCTGGGAGGCCCTGGG - Intergenic
1074063466 10:109990131-109990153 GGCTGGGACAAGGGGGCTTTGGG - Intergenic
1074418100 10:113284900-113284922 GGCAGGGGCTGAGGGGCTCAGGG + Intergenic
1075734123 10:124653671-124653693 GGCTGAGACTGGGAGGGTCCTGG - Intronic
1076065104 10:127442326-127442348 GGCTGGGTCTGGGGGCCTGGTGG - Intronic
1076109714 10:127851250-127851272 GGCTGTGACTGGGAGGCCCCTGG + Intergenic
1076440862 10:130480697-130480719 GGGGAGGACTGGGGGGCCCTGGG - Intergenic
1076560078 10:131356911-131356933 GGCAGGGACTGGGGAGCACGAGG + Intergenic
1076707926 10:132311954-132311976 GGTTGGGACTTTGGGGCTGTAGG - Intronic
1076850548 10:133090321-133090343 GGCTGGGACCGGGTGGCCCCGGG - Intronic
1076887571 10:133269628-133269650 GGCAGGGACCGAGGGGCCCTCGG - Intronic
1076922933 10:133465016-133465038 GCCTGGGCCTGGGGGTCACTAGG + Intergenic
1077048179 11:555329-555351 GGCTGGGCCTGGAGGACTGTCGG - Exonic
1077063495 11:627466-627488 GGGGGGGACTGGGGGGCCCCGGG + Intergenic
1077284739 11:1760656-1760678 GACTGGGCCAGGGGGGCCCTGGG - Intronic
1077297958 11:1834836-1834858 GGCTGGGGCTGGGGGCTGCTGGG + Intronic
1077467072 11:2738521-2738543 GGCTGGGAGTGGGGGGAGGTTGG - Intronic
1077583626 11:3434137-3434159 GTCCGGAACTGGGGGGTTCTTGG + Intergenic
1077598650 11:3556922-3556944 GGATGGGTTTGGGGGGCTTTGGG - Intergenic
1078054079 11:7992944-7992966 GGATGGGGTTGGGGGCCTCTCGG - Exonic
1078171618 11:8932900-8932922 GGCTGGGAGTTTGGGGCTGTGGG - Exonic
1078567803 11:12431740-12431762 GGCAGGGAGTGGGGGGCCCATGG - Intronic
1079074688 11:17376940-17376962 TGCTGGGAATGGCAGGCTCTGGG + Exonic
1079316097 11:19409006-19409028 GGTGGGGAGAGGGGGGCTCTTGG + Intronic
1079333488 11:19552081-19552103 GGCTGAGACTGGGGTGGCCTGGG + Intronic
1079340053 11:19604292-19604314 GGCTTGGACTGGGGGGGCATCGG + Intronic
1080685823 11:34513950-34513972 GGCTGGGAGTGGGGGGTTGCAGG - Intergenic
1081478293 11:43458646-43458668 GGATGGGACTGTGGGGTTCTTGG - Intronic
1081620862 11:44618552-44618574 GGCTGGGACTGGGGGGCTCTCGG + Intronic
1081990032 11:47332763-47332785 GGCTGGGGCAGGGAGGCTGTGGG - Intronic
1083265456 11:61544752-61544774 GGCTGGGAGGGTGGGGCACTGGG + Intronic
1083363489 11:62127757-62127779 GGCAGGGAGTGAGGGGCCCTGGG + Intronic
1083397722 11:62402744-62402766 GGCTGGGTCTGGTGGGGGCTGGG - Intergenic
1083436414 11:62646501-62646523 GAATGGGACTTGGGGGATCTGGG + Intronic
1083625975 11:64072160-64072182 GGCTGGGCCTGGGGGGACTTGGG + Intronic
1083903334 11:65654492-65654514 AGCTGGGTCGGGGGGCCTCTGGG + Exonic
1083935271 11:65866758-65866780 GGCTGGGGCAGGGTGGCACTTGG - Exonic
1084009882 11:66341490-66341512 GGCTGGGTCTGCGAGGATCTGGG - Intronic
1084154001 11:67303804-67303826 GGCTCGGGCTGGAGGGCGCTGGG + Intronic
1084165147 11:67372191-67372213 GGCTAGGGGTGGGGGGCACTGGG - Intronic
1084462295 11:69302667-69302689 GGCTGGGGCTGGTGGTCTCAGGG + Intronic
1084637019 11:70399068-70399090 GGCTGGGCCTGTGGGGTTCGGGG + Intronic
1084681259 11:70667751-70667773 GTATGGGCCTGAGGGGCTCTGGG + Intronic
1084732455 11:71082182-71082204 GGCTGGCACTGTGGAGCTCCTGG + Intronic
1084898682 11:72293954-72293976 GACTGGGTCTGGGGGGCCCTGGG + Intronic
1085299820 11:75451289-75451311 GGCTGTGACATGGGGGCTCGGGG + Intronic
1085640384 11:78189243-78189265 GGCTGGGAGTCGGGAGATCTGGG + Intronic
1086401309 11:86463127-86463149 GGATGGGCCTGGGGGGCTGCAGG + Intronic
1086552697 11:88070456-88070478 GTCTGGAACTGGTGGGTTCTTGG - Intergenic
1087601325 11:100319685-100319707 GGCTGGGACTAGGGAGCAGTTGG - Intronic
1088833189 11:113555495-113555517 GGCTGGACCTGAGGGCCTCTGGG - Intergenic
1089261145 11:117224811-117224833 AGCTGAGACTGGGAGGCGCTGGG - Intronic
1089366331 11:117923216-117923238 GGCTGGAAGTGGGGGGCCTTGGG - Intronic
1089479027 11:118790777-118790799 GGCCGGCTCTGGGGGACTCTCGG - Intronic
1089499621 11:118924803-118924825 GGTTGGGACTGGGGAGAGCTGGG - Intronic
1089893974 11:121908837-121908859 GGATGGAACTTGGGGGCTCTTGG - Intergenic
1090247509 11:125226920-125226942 CGCTGGGGCTGGGAGGCTCTGGG + Intronic
1090333741 11:125949697-125949719 GCCTGAGACTGAGGGGCTCTTGG - Intergenic
1091969854 12:4777707-4777729 AGCTGGGACTCAGGGGCTCCAGG - Intronic
1092241598 12:6839383-6839405 GCCTGCGGCTAGGGGGCTCTGGG - Exonic
1092917167 12:13199357-13199379 GGCTTGCTCTGGGTGGCTCTAGG + Intronic
1093477703 12:19573834-19573856 GGCTGCGACAGAGGGGCTGTCGG + Intronic
1094524049 12:31220035-31220057 GGCTTAGACTGAGGAGCTCTGGG - Intergenic
1095889522 12:47222794-47222816 GGCTGAGAGGGAGGGGCTCTGGG - Intronic
1096513758 12:52145527-52145549 GGCAGGGACTGGGGTGCTCTGGG + Intergenic
1096531440 12:52244997-52245019 GGCTGGGGCTGGGGGACTGGGGG + Intronic
1096569662 12:52514774-52514796 GGCTGGGAATGGGGCTCTCCTGG + Exonic
1096756341 12:53802927-53802949 GGGTGGGAATGAGAGGCTCTGGG + Intergenic
1096837030 12:54357633-54357655 GGCTAGGAATGTGGGGCTCAGGG - Intergenic
1098442356 12:70532315-70532337 GGGTGGGGTTGGGGGACTCTAGG - Intronic
1099155288 12:79167826-79167848 GGCTGGGAATGGGGTGGTTTGGG + Intronic
1099610167 12:84857760-84857782 GGCTGGGACTAGGGTGGACTAGG - Intergenic
1101223305 12:102662731-102662753 GGCTGCAACTGGGGGGTCCTCGG + Intergenic
1101494010 12:105236311-105236333 CGCGGGGAGCGGGGGGCTCTGGG + Intronic
1101583836 12:106067258-106067280 GGCTGGGTCCGGGGGGCTGGGGG + Exonic
1101963402 12:109266117-109266139 AGCAGGGACTCGGGAGCTCTGGG + Intronic
1102514232 12:113435610-113435632 GGCTGGGACTGGAAGGCCCTAGG - Intronic
1103410849 12:120710516-120710538 GGCTGGGCCCGGGGGGCTGGTGG + Exonic
1103983989 12:124755128-124755150 GGCTGGGCCTCGGGCGCCCTGGG - Intergenic
1104847235 12:131852703-131852725 GGATGGGACAAGGGGGCTGTGGG - Intergenic
1104934226 12:132355965-132355987 GGTGGGGACTGGTGGGCTCAGGG - Intergenic
1104953730 12:132453890-132453912 GGCTGGGGCTGGAGGGCTGCTGG + Intergenic
1104963688 12:132499696-132499718 GGCTGTGGCTGGGGGGCTGCAGG + Intronic
1105204276 13:18207055-18207077 GGATGGGGTTGGGGGCCTCTCGG + Intergenic
1105327661 13:19384607-19384629 GGGTGGGATTGTGGGGCTCCTGG + Intergenic
1106793699 13:33182952-33182974 GCCTGGGACTGGGGATCTCCGGG - Intronic
1111197456 13:84893966-84893988 GTCTGGAATTGGTGGGCTCTTGG + Intergenic
1112174748 13:97010887-97010909 GGCTGAGACTCGGGGCCTCTGGG - Intergenic
1113066081 13:106375317-106375339 GGCTGGGGCTGGAGGGGACTTGG - Intergenic
1113106087 13:106772766-106772788 GGGTGGGAGTGGAGGGCTCCTGG - Intergenic
1113775029 13:112939279-112939301 ATCTGGGGCTGGGTGGCTCTTGG + Intronic
1113811626 13:113146276-113146298 GCCTGGGACTGGGAGGATTTCGG - Intronic
1113889900 13:113730315-113730337 TGCGGGGACTGGGGGACTGTCGG - Intronic
1114587610 14:23828336-23828358 GGCTAGAACTGGGTGGGTCTGGG + Intergenic
1115669761 14:35597569-35597591 GTTTTGCACTGGGGGGCTCTGGG - Intronic
1115787040 14:36837661-36837683 GGCTGGGATTGGAGAGCTCAAGG + Intronic
1115935335 14:38545867-38545889 GGCTGGAAATGGGGGGATTTTGG + Intergenic
1117727179 14:58686422-58686444 GTCTGGAACTGGTGGGTTCTTGG + Intergenic
1118362636 14:65069240-65069262 GGCTGGGGGTGGGGGGCTGTTGG - Intronic
1119113439 14:71996535-71996557 GGTTGGGACTGGGGGCAACTGGG + Intronic
1119788537 14:77329818-77329840 GGCTGGGCCTGGGGAGGTCTGGG - Intronic
1120011343 14:79418905-79418927 GTCTGGGAATGTGGGACTCTAGG + Intronic
1121054176 14:90839418-90839440 GGCAGGGCCTGGGTGGCCCTTGG - Intergenic
1122115997 14:99527570-99527592 GCCTGGGACTGGGGAGCTGCTGG - Intronic
1122411229 14:101527167-101527189 GGCTGGGCCCAGGGGCCTCTGGG - Intergenic
1122635513 14:103127840-103127862 GGCTGGGTCTGCGTTGCTCTTGG + Intronic
1122716769 14:103700790-103700812 TGCAGGGACTGGGGGGAGCTGGG + Intronic
1122882650 14:104697001-104697023 GCCTGGGACCAAGGGGCTCTGGG - Intronic
1122978702 14:105181536-105181558 GGGTGGGACTCGGGACCTCTTGG + Intergenic
1123037839 14:105478633-105478655 GCTGGGGACTGGGGGGCACTAGG - Intronic
1123053709 14:105559740-105559762 GGCAGGGGCAGGGGCGCTCTCGG - Intergenic
1123932298 15:25177754-25177776 TCCTGGGACTCGTGGGCTCTGGG + Intergenic
1123986658 15:25652480-25652502 GGCTTGGAGAGGGAGGCTCTAGG + Intergenic
1124204055 15:27702247-27702269 GGCTAGGACTGCAGGGGTCTGGG + Intergenic
1124473214 15:30007367-30007389 GCCTGGGGCTGGGGGGTTCATGG + Intergenic
1124639968 15:31391383-31391405 GGCTGGGTTTGTGGGGCTGTAGG + Intronic
1124790074 15:32718610-32718632 CGCTGGGTCTGGGGGCGTCTTGG + Intronic
1125579005 15:40772792-40772814 GGCTAGGGCTGTGGGGCTCCTGG - Intronic
1125716471 15:41822507-41822529 GGCTGTGGCTGGGGGTCTCAAGG + Intronic
1125724790 15:41862684-41862706 GGCTGGGGCAGGGGAGCTCTGGG + Intronic
1126730927 15:51681610-51681632 GGCCGGGACTGGGCGGCTGCAGG - Exonic
1127860312 15:62988420-62988442 GGCTAGGGCTGGGTGGTTCTGGG - Intergenic
1128226620 15:66006193-66006215 GGCTGGGACTGGGGAGAGATGGG + Intronic
1128520561 15:68372081-68372103 GGCTGGGACTGGAGTTCTCCTGG + Intronic
1129232195 15:74203020-74203042 GGCAGGGGCTTGGGAGCTCTGGG - Intronic
1129405138 15:75312102-75312124 AGCTGGGGCTGGGGGCCTCCTGG - Intergenic
1129478811 15:75807000-75807022 AGCTGGGGCTGGGGGCCTCCTGG - Intergenic
1129516935 15:76162722-76162744 GGCAGGGACCAGGGGTCTCTGGG + Intronic
1129905401 15:79183645-79183667 GCCTGGGTCAGGGGTGCTCTGGG + Intergenic
1130018816 15:80209787-80209809 GGCTGGGAGTGAGGTGCTCAGGG + Intergenic
1130255368 15:82323457-82323479 GGGGGGGACTGGGGGGCTGGGGG - Intergenic
1131050838 15:89346846-89346868 CGCTGGCAATGGGGGGCCCTTGG - Intergenic
1131178307 15:90223783-90223805 GGCTGGGACTGGGGCCCCCAGGG + Intronic
1131507944 15:93032897-93032919 GTCTGGAACTGGTGGGTTCTTGG - Intergenic
1132014962 15:98307476-98307498 GGCTGGGAATGGATGGGTCTTGG + Intergenic
1132194082 15:99897160-99897182 GGGTGGGAGTGGGGGGCTCATGG - Intergenic
1132501199 16:285433-285455 GGCAGGTACTGGGGGGCTGGGGG + Exonic
1132751036 16:1457855-1457877 GGCTGGGACACGGGGCCTCCGGG + Intronic
1132762058 16:1513623-1513645 TGCTGGGAGTGGGTGGCACTGGG + Intronic
1133136641 16:3717164-3717186 GGCTGGGTCTTGGGGGGTCGCGG - Intronic
1133324506 16:4935146-4935168 TGCAGGGACTGGGAGGGTCTGGG - Intronic
1133439007 16:5805006-5805028 TGCTGTGACTTGGAGGCTCTGGG + Intergenic
1133860702 16:9592306-9592328 GCCAGAGACTGGGGGACTCTGGG - Intergenic
1134589886 16:15443951-15443973 GGCTGTGACTGGGGAGCTGCAGG + Intronic
1135404643 16:22189670-22189692 GGCTGCGACTGGGGCCCTCCTGG + Intronic
1135415672 16:22266564-22266586 GGCTGGAGCTGGGGGGCTCCAGG - Intronic
1136064886 16:27751929-27751951 GACTGGAGCTGGGGGGCTGTGGG + Intronic
1136548071 16:30966398-30966420 GCCTGGGACCGGGGAGCCCTGGG + Intronic
1137054216 16:35735674-35735696 GGCTGGGCCTGGCTGGGTCTTGG + Intergenic
1137235450 16:46613241-46613263 GGCTCGAACTGTGGGGCTCAAGG - Intronic
1137542914 16:49377259-49377281 GGGTGGGCCTGGGGTGCTCCGGG + Intronic
1137744269 16:50809388-50809410 GCATGGCAGTGGGGGGCTCTGGG + Intergenic
1138556247 16:57772725-57772747 GGCTGGGCCAGGGTGGATCTAGG - Intronic
1139594835 16:67951519-67951541 GGCGGGCAGTGGCGGGCTCTGGG - Intronic
1140424727 16:74851284-74851306 GCCTGGGTCTTGGGGGCTCCTGG - Intergenic
1140835766 16:78792260-78792282 GGCTGGGAATGGGCTGATCTAGG + Intronic
1140838974 16:78821332-78821354 GGTGGGGGCTGGGGGGCGCTTGG - Intronic
1141667083 16:85471163-85471185 AGCAGGGACTGGGCGTCTCTGGG - Intergenic
1141694609 16:85613616-85613638 GGCGGGGACTCGGGGGCTCCGGG + Intronic
1141776167 16:86123840-86123862 GGCTGGGATTGGGGGGCAGGTGG + Intergenic
1141980579 16:87547605-87547627 GGGAGGGACTGAAGGGCTCTGGG + Intergenic
1142066795 16:88067472-88067494 GGCTTGTCCTGAGGGGCTCTAGG + Intronic
1142113879 16:88346403-88346425 GGCTGGGAGGGAGGGGCTCCGGG - Intergenic
1142148501 16:88502557-88502579 GGAAGGGACAGTGGGGCTCTGGG - Intronic
1142509761 17:386070-386092 GGCGGGGACCTGGGAGCTCTTGG - Intronic
1142640078 17:1280492-1280514 AGCTGGGAGTGGGGGGCTTGGGG + Intronic
1142878124 17:2864609-2864631 GGCTGGGGGTTGGGAGCTCTGGG + Intronic
1142903835 17:3029437-3029459 GGGTGGGCTTGGGGGGATCTGGG + Intronic
1143036857 17:4004326-4004348 GGCGGAGACTCGGGGGCTCAGGG - Intergenic
1143079685 17:4372155-4372177 GGCTGGGACTTGCGGGCCGTGGG - Intergenic
1143188289 17:5023685-5023707 TGCAGGGACTGCAGGGCTCTGGG + Exonic
1143430240 17:6876731-6876753 GGCTGCAACTGGGGGGTCCTCGG + Intronic
1143471117 17:7176928-7176950 GGCTGGGGCTGGGGGGCTGTCGG - Intronic
1144283454 17:13749688-13749710 GTCTGGCACTGGGGGGGTGTAGG + Intergenic
1144473292 17:15563296-15563318 GGCCGGGAGTGGAGGGCTGTGGG - Intronic
1144665378 17:17098709-17098731 GGCTGGGGCTTGGGAGCCCTGGG - Intronic
1144764981 17:17727651-17727673 GGGTGGGACTGTAGGTCTCTGGG + Intronic
1144792430 17:17868018-17868040 TGCTTGGACTGGGAGACTCTTGG + Intronic
1144923190 17:18781424-18781446 GGCCGGGAGTGGAGGGCTGTGGG + Intronic
1144948047 17:18979827-18979849 GTCTGGGACTGCAGGGCTCAGGG + Intronic
1145220525 17:21084824-21084846 GTCTGGCACTGGTGGGTTCTTGG + Intergenic
1146176368 17:30668380-30668402 GGTTGGGAGTGGGGGGCGCTGGG + Intergenic
1146349828 17:32084494-32084516 GGTTGGGAGTGGGGGGCGCTGGG + Intergenic
1147190677 17:38736222-38736244 GGCTGGGAATGTGGGGGACTGGG + Intronic
1147551417 17:41445183-41445205 AGCTGGGACCGTGGGGCCCTGGG - Intergenic
1147718193 17:42521992-42522014 GTGTGGGACTGGGGTCCTCTTGG + Exonic
1147935329 17:44007516-44007538 GGCGGGGTCTGGGGGGCAGTCGG + Intronic
1148107660 17:45128005-45128027 GGCCGGGGCTGTGAGGCTCTAGG + Intronic
1148110936 17:45144401-45144423 GGCTGGGAGCGGGGCGCCCTTGG + Intergenic
1148542539 17:48492290-48492312 GGGTGGGATTGGGGGGCTGGGGG - Intergenic
1148581902 17:48750015-48750037 GGCTGGGTCTGGAGGGCTGGCGG + Intergenic
1149990227 17:61379067-61379089 GGCTTGGACTGAGGGGCTGGGGG + Intronic
1150128518 17:62653718-62653740 GGCTGGGATGGAGGGGCTGTTGG + Intronic
1150461414 17:65356758-65356780 GGCTGCCACTGAGGAGCTCTCGG - Intergenic
1151009088 17:70472877-70472899 GGCTGGCAATGGTGAGCTCTGGG - Intergenic
1151396490 17:73826600-73826622 GTCTGGGTCTTGGGTGCTCTGGG - Intergenic
1151429645 17:74053664-74053686 GGCTGGGCCTCAGAGGCTCTCGG - Intergenic
1151522677 17:74641553-74641575 GGGTGGGGCTGGGGTGCACTGGG - Intergenic
1151573540 17:74939416-74939438 GGGTGGAACAGGGGGTCTCTAGG + Intronic
1151801735 17:76383306-76383328 GGCTGGGACGCGGGGTCCCTGGG - Intronic
1152088929 17:78236487-78236509 AGCTGGGACTGGGGGGCCCTCGG - Intronic
1152368489 17:79870804-79870826 GGCCAGGACGGGAGGGCTCTGGG + Intergenic
1152374400 17:79911605-79911627 GGCTGGGACTGAGGGTCCTTCGG + Intergenic
1152394751 17:80025621-80025643 GGGTGGGGGTGGGGGGCTCCTGG - Intronic
1152444598 17:80334246-80334268 TGCTGGGTCCGGGAGGCTCTTGG + Exonic
1152626083 17:81388523-81388545 GGCTGGGTCTGGGAGGTGCTTGG + Intergenic
1152758954 17:82098442-82098464 GGCTGGGACTGAGGAGCGCCGGG + Intergenic
1152814170 17:82397687-82397709 GGCTGGGGCTCTGGGACTCTGGG + Intronic
1152848144 17:82615164-82615186 GGCGGGGACGGGGGGTCTCCTGG - Exonic
1152885358 17:82846141-82846163 GGATGGGACTGGGAGGCTTAGGG + Intronic
1153474869 18:5488410-5488432 GTCGGGGACTGGGGGGCTAGGGG + Intronic
1153971856 18:10234368-10234390 GGCTGGGACAGGTGGGCTGAGGG + Intergenic
1154218303 18:12431639-12431661 GGCTCTGACTGCGGGGCTCACGG + Exonic
1156499383 18:37547486-37547508 GCCTGGGGCTGGGTGGCTCTTGG + Intronic
1157763651 18:50282244-50282266 GGCTGGGAATGTGGGTCCCTGGG + Intergenic
1158150035 18:54357745-54357767 GGCTGGGAATGGGGGGATGTGGG - Intronic
1159385727 18:67723547-67723569 GTCAGGGACTGGGGGGCTAGGGG - Intergenic
1159605334 18:70468895-70468917 GGATGGGAGAGGGTGGCTCTTGG + Intergenic
1159947614 18:74456422-74456444 GGCTGGGACCGGGAGGATCCCGG - Intronic
1160406979 18:78652891-78652913 TCCTGGGACTGAGGGGCTCCAGG - Intergenic
1160555365 18:79721139-79721161 GGCTGGGCCTGAGCGGCTCCAGG - Intronic
1160716386 19:578653-578675 GCCTGGGGCTGGGGGGATGTGGG + Intronic
1160770126 19:827465-827487 GCCTGGCACCGGGGGGCTCAGGG - Intronic
1160801862 19:974090-974112 GGTTGGGAGTGGGGGGAGCTGGG - Exonic
1160828577 19:1091972-1091994 GGCTGGAACCTGGGTGCTCTGGG - Intronic
1160949600 19:1659051-1659073 GGCAGGGACTTTCGGGCTCTGGG - Intergenic
1160975109 19:1789276-1789298 TGGTGGGACTGGGGGGACCTGGG - Intronic
1161260841 19:3337019-3337041 GGCTGGGGGTGGGGTGCTCCGGG + Intergenic
1161299675 19:3536756-3536778 GGCCGGGACTGGCTGGCTCTAGG + Intronic
1161323082 19:3650173-3650195 GGCTGGCACTGGCTGGCACTAGG - Intronic
1161395869 19:4044557-4044579 GGCTGGGGTTGGGGGGCTTCAGG - Exonic
1161545106 19:4875794-4875816 GGCAGGGGCCTGGGGGCTCTGGG + Intergenic
1161558670 19:4958421-4958443 GGCTGGCTGTGGGGGGCTATTGG + Intronic
1161581873 19:5085668-5085690 GGCTGGGACAGCGGGGCTGGGGG - Intronic
1161672774 19:5623424-5623446 GGGTGGGTCTGGGGTCCTCTTGG + Intronic
1161714622 19:5868243-5868265 GGCAGGGAGTGGGGGGATCTGGG + Intronic
1161973580 19:7596698-7596720 GGCGGCGACCGGGGAGCTCTGGG + Intronic
1162159133 19:8698638-8698660 GGCCGGGCCTGGGGGCCTCCAGG + Exonic
1162282804 19:9713092-9713114 GGCTGCAACTGGGGGGTCCTTGG + Intergenic
1162439753 19:10685844-10685866 AGCTGGGGCTGTGGGGCTGTGGG + Intronic
1162736942 19:12752040-12752062 GGCTGGGGCAGGGGGGCTAGGGG + Intronic
1162922553 19:13912259-13912281 GGATGGGAAATGGGGGCTCTTGG + Intronic
1162982457 19:14248517-14248539 GGTTGGGAGTGGGGGGCGCTGGG - Intergenic
1163019945 19:14476557-14476579 GGCTAGGTCTAGGGGTCTCTAGG - Intergenic
1163042994 19:14616440-14616462 GCCTGGGACTGAGGGACTCCTGG + Intergenic
1163255317 19:16152665-16152687 GGCAGGGGCAGGTGGGCTCTTGG + Intronic
1163378949 19:16951794-16951816 GGCTCAGCCTGGGGGGCTTTGGG - Intronic
1163728964 19:18938989-18939011 GGCTGGGATGGGCAGGCTCTAGG + Exonic
1163827905 19:19533864-19533886 GACTGGGACTGAGGGGCTTCTGG - Intronic
1163845176 19:19634598-19634620 GGCTGGGGCTGGGGGTCCCAGGG + Exonic
1164575533 19:29403369-29403391 GGCTGGGCCTGGGGCACCCTGGG + Intergenic
1165102364 19:33446570-33446592 GCATGTGACTGTGGGGCTCTCGG - Intronic
1165236865 19:34428616-34428638 GGCTGGGATTCGGGGGTTCCGGG + Intronic
1165310457 19:35026475-35026497 GGCTGTGCCTGTGGGGCCCTGGG + Intergenic
1165445804 19:35856312-35856334 GGCTGGGACTGCGGGGTCCTGGG + Intronic
1165476144 19:36032255-36032277 GGGTGGGGCTGGGGGCCTCGGGG + Exonic
1166122252 19:40692821-40692843 CCCGGGGACTGGGGGACTCTAGG - Intronic
1166299258 19:41904895-41904917 GGCAGGCACTGGGGGGACCTGGG + Intronic
1166369399 19:42292794-42292816 GGCAGGGGCTGGCGGGCCCTTGG - Exonic
1166420304 19:42631392-42631414 GGCCTGGCCTGGGGGGCCCTCGG - Intronic
1166538458 19:43590954-43590976 GTCTGGGCATGGTGGGCTCTGGG - Exonic
1166669693 19:44702433-44702455 GGCTAGGAGTGAGGGTCTCTGGG - Intronic
1166792122 19:45404722-45404744 CCCTCGAACTGGGGGGCTCTAGG - Intronic
1166863950 19:45825141-45825163 GGCAGGGCCTGGTGGGCTCAGGG + Intronic
1166878883 19:45914729-45914751 GGCTGGGGCTGGGGGCCCGTGGG + Exonic
1167007960 19:46787744-46787766 CGCTGGGACTGGGGGTGTCGGGG - Exonic
1167044284 19:47040742-47040764 GGGGGGGTCTGGGGGGCTGTGGG + Intronic
1167268375 19:48494296-48494318 CGTTGGCACTGGGGAGCTCTGGG - Intronic
1167396522 19:49233024-49233046 GGCTAGGAATGGTGGGCTGTGGG + Intergenic
1167707504 19:51090304-51090326 TGCTGGGACTGGGGAGCTGAGGG + Intergenic
1167863193 19:52302020-52302042 GGCTGCAACTGGGGGGTCCTCGG + Intronic
1167981235 19:53277410-53277432 GGGAGTGACTGTGGGGCTCTGGG + Intergenic
1168145250 19:54416611-54416633 GGCTGGGATTGGAGAGCTCAGGG + Intronic
1168146035 19:54420554-54420576 GGCGGGGACGGGAGGGGTCTGGG + Intronic
1168184845 19:54693647-54693669 GTCTGGGGCTGGGGGGCTGGGGG - Intronic
1168319360 19:55500071-55500093 GGTTAGGTCTGGGGGGCTTTGGG - Exonic
1168669373 19:58229277-58229299 GGGTGGGACTGGGTGGGACTGGG + Intronic
1168669377 19:58229287-58229309 GGGTGGGACTGGGTGGGACTGGG + Intronic
1168669381 19:58229297-58229319 GGGTGGGACTGGGTGGGACTGGG + Intronic
1168679152 19:58301139-58301161 GGCTGGGTTTGGGGAGCTTTCGG - Exonic
925286400 2:2718455-2718477 TGCTGGGATTGAGGGCCTCTGGG - Intergenic
925375402 2:3380201-3380223 GCCTGGAACTGGGGGTCTCGGGG - Intronic
926047089 2:9717769-9717791 GGCTGGGAGAGGGGGACTCAGGG + Intergenic
926138069 2:10351393-10351415 GGCTGGGACTGGGAGGCTGAGGG + Intronic
927133516 2:20080301-20080323 GGCTGGGACAGGGTGTTTCTGGG - Intergenic
927695814 2:25239095-25239117 TCCTGGGCCTGGGGGGCTGTGGG - Intronic
927826905 2:26315609-26315631 GGATGGGACTGGGGCTCCCTGGG + Exonic
929452564 2:42047481-42047503 TCCTGGGACTGGGGGCCTCGGGG - Intergenic
929549299 2:42879393-42879415 GGCCAGGACAGGGGAGCTCTAGG - Intergenic
929602696 2:43214453-43214475 GGCTGGGACCGGAGGGAGCTTGG - Intergenic
930021652 2:47005226-47005248 GGAAGGGAGGGGGGGGCTCTGGG + Intronic
931036721 2:58252024-58252046 GGATGGGGTTGGGGGCCTCTCGG - Intergenic
932424176 2:71618878-71618900 TGCTGGGGCTGGCCGGCTCTGGG + Intronic
932481550 2:72042386-72042408 GCCTGGGCCTGGGGAGGTCTAGG + Intergenic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
933948567 2:87308945-87308967 GGCTGGGGGTGGCGGGCTCTTGG + Intergenic
935627718 2:105185098-105185120 GCCAGGAACTGGGGGGCACTAGG + Intergenic
935888451 2:107649307-107649329 GGCAGGGAATGGGGGGCGCGAGG - Intergenic
936331632 2:111552650-111552672 GGCTGGGGGTGGCGGGCTCTTGG - Intergenic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
937231828 2:120402543-120402565 GGGTGGGAGTGGAGGGCTCCAGG + Intergenic
938169005 2:129058383-129058405 AGATGGGGCTGGGGAGCTCTTGG - Intergenic
939783133 2:146474593-146474615 GCCTGGGACTGGGAGGCTACAGG + Intergenic
940694408 2:156960023-156960045 AGCTGTGACTGGGGAGCACTAGG + Intergenic
942757672 2:179361564-179361586 GGCTGGAAGTGTGGGGCTGTTGG + Intergenic
943062306 2:183051846-183051868 GGCTGCAACTGGGGGGTCCTCGG + Intergenic
943063236 2:183060578-183060600 GGGTGGGTCTGGTGGGGTCTGGG + Intergenic
944019141 2:195079615-195079637 GTCTGGGGCTGGGGGGCTGGGGG + Intergenic
944243602 2:197509422-197509444 GGATGGGACTGGGTGGCTGGGGG - Intronic
945577829 2:211554446-211554468 GGGTGGGAATGTGTGGCTCTGGG - Intronic
945763552 2:213944677-213944699 GGCTGGGAATGGAGTGCTATGGG + Intronic
946102301 2:217336329-217336351 GGGTGGCACTGGTGGCCTCTGGG - Intronic
946333204 2:219021975-219021997 GGCTGGGAGAGTGGGGCTGTGGG - Intronic
947318392 2:228889925-228889947 GGCTGTGTCTGGAGGGCGCTGGG - Intronic
947624555 2:231611637-231611659 GGCTGGGGCAGGATGGCTCTGGG + Intergenic
947673548 2:231958254-231958276 GGCTGGGACTGAGAGGTTCTGGG + Intergenic
947764008 2:232624285-232624307 AGCTGGGGCTGGGGGACTTTAGG - Intronic
948216893 2:236238967-236238989 GGCTGGGCCTTGGGGACTCAGGG - Intronic
948438354 2:237968482-237968504 GGATGGGACTGCGGGTCACTAGG - Intronic
948546092 2:238729953-238729975 GGCAGGGACTGGGAGCCTCATGG - Intergenic
948904316 2:240971056-240971078 GGCTAGGAGTGGGGAGCCCTTGG - Intronic
949025137 2:241764187-241764209 GGCGGGGACTGGGGGGCGACGGG + Intronic
949031698 2:241800150-241800172 GGCTGGGGCTGAGGGTCTCTAGG + Intronic
1168953293 20:1817282-1817304 GACTGGGGCTGGGGGGCGATGGG - Intergenic
1169208962 20:3755089-3755111 GTCTGGGACTGGTGGGTGCTAGG + Intronic
1169278988 20:4251164-4251186 GGCTGGGGCTGGGGTGCTGGGGG + Intergenic
1171470872 20:25370272-25370294 GGTTGTGACTGGGAAGCTCTGGG - Intronic
1172158239 20:32844838-32844860 CGCTGGGGCTGGTCGGCTCTTGG + Intronic
1172164944 20:32893371-32893393 GGCAGGGAGTGGGGGGCTCGGGG - Intronic
1172699759 20:36845832-36845854 AGCTGGGGGTGGGGGGCCCTGGG + Intronic
1172846934 20:37935219-37935241 GGCTGGGGGTGGGGGGCTGGGGG - Intronic
1173664210 20:44753536-44753558 GGCTGGCACTAGGGGCCACTGGG - Intronic
1174192496 20:48750223-48750245 GGCTTGGACTGGGGGGGTGGTGG - Intronic
1174447727 20:50601999-50602021 GACTGGGAGTCGGGGGCTCTGGG - Intronic
1174798081 20:53539340-53539362 GGACAGGACTGGGGGGCCCTGGG + Intergenic
1175409878 20:58760240-58760262 GTCTGGGGCTGGGGAGGTCTTGG + Intergenic
1175878467 20:62242732-62242754 GGAAGGGTCTGAGGGGCTCTTGG + Intronic
1176083437 20:63285199-63285221 GGCTGGGGGTGCTGGGCTCTGGG - Intronic
1176086238 20:63296829-63296851 AGCAGGGGCTGGGGGGCACTGGG - Intronic
1176106555 20:63392259-63392281 AGCAGGGGCTGGGGGGCACTGGG + Intergenic
1176132457 20:63502068-63502090 GGATGGGTCCTGGGGGCTCTGGG - Intergenic
1176193010 20:63822429-63822451 CCCTGGGACTGATGGGCTCTAGG + Intronic
1176713701 21:10331030-10331052 GGATGGGGTTGGGGGCCTCTCGG - Intergenic
1179590363 21:42404069-42404091 GGCTGGGCCCCGGGGTCTCTGGG - Intronic
1179921472 21:44509883-44509905 GGCTGGGACTAGAGGGATCAGGG - Intronic
1179979264 21:44887958-44887980 GGCTGGGGCTGGGGGGCCGCTGG - Intronic
1179984057 21:44911585-44911607 GGCAGGGACTGCAGGGCTCCTGG - Intronic
1180018296 21:45102014-45102036 AGCTGGGACTGTGGGGCTACAGG + Intronic
1180081893 21:45490893-45490915 GGATGGGGATGGGGGGCGCTGGG + Intronic
1180190818 21:46161723-46161745 GGATGGGGGTGGGGGGCTCGGGG + Intronic
1180559266 22:16602135-16602157 GTCTGCGGCTGGGGGGCTCGGGG - Intergenic
1180920305 22:19518268-19518290 GGCTGGGTCTGGGGCTCTCGGGG + Intronic
1180922092 22:19526192-19526214 GGCTGGGAGTAGGGGGATCTGGG - Intronic
1180981439 22:19879858-19879880 GGGTGGGGCTGGGGGCTTCTGGG + Intronic
1181031630 22:20150921-20150943 GGCTGGGGTTGGGGGACACTGGG + Intergenic
1181049360 22:20231341-20231363 GGCTGGGGCAGGAGGGCTGTGGG + Intergenic
1181068958 22:20320636-20320658 GGCCGGGGCTGGGGGGCTTCTGG + Intergenic
1181292020 22:21802475-21802497 GGCTGGGACTGGGAGGCAGCAGG - Intronic
1181312360 22:21952347-21952369 TGCAGGGACTGGGGGGATATGGG + Intronic
1181511771 22:23392596-23392618 GGCTGCGGCTGGGGGACACTGGG - Intergenic
1182368348 22:29793505-29793527 GCATGGGTCTGGGGGGCTCAGGG + Intronic
1182741511 22:32571320-32571342 GGCTGGCCCTGGGTTGCTCTGGG + Intronic
1183333113 22:37231897-37231919 GGGTGGGCCTTGGGGGCTCTGGG - Intronic
1183368246 22:37418435-37418457 GGGTGGGAGTGGGGGCCCCTTGG - Intronic
1183381478 22:37492490-37492512 GGCTGAGCCTTGGGGGCTCCAGG + Exonic
1183403748 22:37619862-37619884 GGGTGGAACTGGGAGGCCCTGGG - Intronic
1183484732 22:38082806-38082828 GGCTGGGGCTGGGTGGTGCTGGG - Exonic
1183521551 22:38298620-38298642 GGATGAGGCTGGAGGGCTCTGGG + Intronic
1183537795 22:38413188-38413210 GGTTTGGAGTCGGGGGCTCTGGG + Intergenic
1183947399 22:41334452-41334474 GGCAGGGACTGGGGGGGGCCTGG - Intronic
1184093040 22:42302276-42302298 GGCTGCAGCTGGGGGTCTCTAGG + Intronic
1184167055 22:42735847-42735869 GACTGGGACTCAGGGGCTCCCGG - Intergenic
1184215364 22:43063345-43063367 TGATGGGACTGGGAGGCTCTAGG - Intronic
1184273280 22:43396811-43396833 GGCTGGGGGTGGTGGGCCCTTGG + Intergenic
1184343818 22:43900881-43900903 GGGTGGGCCTGGGGGGCTCCAGG + Intergenic
1184710273 22:46245562-46245584 AGCTGGGACGGGAGGACTCTGGG - Intronic
1184768019 22:46582064-46582086 GGCTGGGGCTGGGTGGGGCTGGG + Intronic
1184988544 22:48152716-48152738 GGCTTGGGGTGGGGGGCTCCAGG - Intergenic
1185079596 22:48702330-48702352 GGCTGGGACTCGGGGGCTGTGGG + Intronic
1185165504 22:49260010-49260032 GGCTGGGCCTGGAGGCTTCTCGG - Intergenic
1185231830 22:49688070-49688092 CGCTGGGCCTGGATGGCTCTTGG - Intergenic
1185245768 22:49771921-49771943 AGGTGGGAGTGGGGGTCTCTGGG - Intergenic
1185296307 22:50057007-50057029 GGGAGGGTGTGGGGGGCTCTGGG + Intergenic
1185398997 22:50606328-50606350 GGCTGAGGCTGGGGGGCAGTAGG + Intronic
950204668 3:11070127-11070149 GTCTGGAACTGGTGGGTTCTTGG + Intergenic
951045815 3:18037281-18037303 GGCTGGGACTTCAGGGCCCTTGG + Intronic
951991772 3:28683301-28683323 GGCTAGGAGTGGTGGGGTCTGGG + Intergenic
953741380 3:45541976-45541998 GGCAGGGACTGCTGGGTTCTGGG - Intronic
954057141 3:48036299-48036321 GGATGGGATTGGGTGGCTGTGGG - Intronic
954426088 3:50443824-50443846 GGCTGGGAGTGAAGGGCTCTGGG + Intronic
954436313 3:50498263-50498285 GGGTGGGACTTGGGGGGTTTGGG - Intronic
954691879 3:52400009-52400031 GGCTGGGGCTTGTAGGCTCTTGG - Intronic
954760334 3:52869296-52869318 GGCTGGCACTGGAGGGTTTTAGG - Intronic
954797504 3:53168967-53168989 GGCTGGAACAGGGGGACTGTCGG + Intronic
954836737 3:53476394-53476416 GCCAGGGAGTGGGGGGCTCAGGG - Intergenic
955401518 3:58595127-58595149 GAGTGGGACTGGGGGGGTGTGGG - Intronic
956732073 3:72205483-72205505 GACTGGGACAGGGGGTGTCTAGG - Intergenic
958785622 3:98593657-98593679 GGCGGGAACTGGGGCGCGCTGGG + Exonic
960868397 3:122226099-122226121 GTCTGGAATTGGTGGGCTCTTGG + Intronic
961452581 3:127009062-127009084 AGCTGGTCCTGGGGGCCTCTCGG + Intronic
961470020 3:127105699-127105721 AGCTGGGACTGGAAGGCACTGGG + Intergenic
961648679 3:128406368-128406390 GGGTGGGAATGGGGAGATCTTGG + Intronic
962385173 3:134927078-134927100 GGCTAGGACAGGGTGGCCCTGGG + Intronic
964172398 3:153786156-153786178 GGCTTGGACTGGGGTGCTGTTGG + Intergenic
968817060 4:2827686-2827708 GGGTGGGCCCGGGGAGCTCTGGG + Intronic
968942159 4:3644455-3644477 TGCTGGGCCTGGGGGGTGCTGGG + Intergenic
968956276 4:3721397-3721419 GGCTGGGACCTGGGGGCTGGGGG + Intergenic
969815084 4:9680947-9680969 GTCTGGAACTGGTGGGTTCTTGG - Intergenic
970699312 4:18715779-18715801 GGCAGGGACTTTGGGGATCTAGG + Intergenic
977652657 4:99487969-99487991 GGCTGCCACTGGGGGGTCCTTGG + Intergenic
979989693 4:127361311-127361333 GGCTGGGAGTGGTGTGATCTCGG - Intergenic
982751679 4:159169577-159169599 GGCTGGGGAGGGGGGGCTGTTGG - Intronic
984170114 4:176349167-176349189 GGCTGCAACTGGGGGGTCCTCGG - Intergenic
984743852 4:183194105-183194127 GGCTGGGACTGGGGAGGGGTTGG + Intronic
984779657 4:183513727-183513749 GGCTGGGAACTGGGGACTCTTGG + Intergenic
984864239 4:184267688-184267710 GGCTGGGTCTTGGGGTCTCCGGG + Intergenic
985634749 5:1030464-1030486 GGCTGCAACTCTGGGGCTCTGGG + Intronic
988504230 5:31807801-31807823 GGAGGGGGCTGGGGGGCTCAGGG + Intronic
992104241 5:73436929-73436951 GGCCGGGACGGGAGGGCGCTGGG - Intergenic
992159270 5:73984772-73984794 GCTTGGGACTTGGGGACTCTGGG - Intergenic
992320873 5:75611952-75611974 GGCTGGGACTCGGGGTCCCAGGG - Intronic
992372882 5:76163126-76163148 GGCTGGAACTGTGGGGCTAATGG - Intronic
996540750 5:124628603-124628625 GGCTGGCACTGGTGGGACCTGGG - Intergenic
997226275 5:132211611-132211633 GCCAGGGACTGGGGGGCTCCTGG + Intronic
997254739 5:132419834-132419856 GGCGGGGAGTGGGGGGCCCAGGG - Exonic
997528515 5:134568447-134568469 GGCTGAGGTTGGCGGGCTCTGGG + Intronic
998088038 5:139342464-139342486 CGGAGGGACTGGCGGGCTCTTGG + Exonic
998372777 5:141672042-141672064 GGCTGGGACTAGAGGGCTCAGGG - Intronic
998386042 5:141757712-141757734 GGCTGGGACTGGGAGGTCCCTGG + Intergenic
999132444 5:149294809-149294831 GGCTGGGGCTGGGGGGAGGTGGG - Intronic
999300460 5:150486910-150486932 CGGTGGGACGGGTGGGCTCTAGG + Intronic
999933355 5:156457983-156458005 GGCTGGGACTGGGGAGGGGTTGG - Intronic
1000587223 5:163115263-163115285 GGCTGGGACTTAGGGGGACTAGG - Intergenic
1001293963 5:170485780-170485802 GGCTGGGGCTGGGGGTCCTTGGG - Intronic
1001560972 5:172668769-172668791 GGCGGTTCCTGGGGGGCTCTGGG - Intronic
1001666231 5:173435732-173435754 GGCTGGGAGGGAGGGGCTCGAGG - Intergenic
1001871469 5:175159738-175159760 GTCTGGGACTAGGAGGCTCTGGG + Intergenic
1002081204 5:176738490-176738512 GGCTGAGCCTGGGGAGCTCTAGG - Intergenic
1002566790 5:180116667-180116689 CGCTGGGACACGGGGGCTGTGGG - Intronic
1002912090 6:1498190-1498212 GGGTGTGACTGGGGGAGTCTGGG + Intergenic
1003298850 6:4858521-4858543 GGCTGGGGCTGTGTGGCTCTGGG - Intronic
1003873265 6:10417713-10417735 GGCTGGGCCTGTTGGGCTCCCGG - Intronic
1004561914 6:16760378-16760400 GGCCCGGACTGGGGCGCTCGCGG + Intronic
1006024457 6:31138354-31138376 GGCTGGGGCTGGGTGGGGCTGGG - Intronic
1006266945 6:32933430-32933452 GTCTAGGAATGGGGGGCTTTGGG - Intergenic
1006282496 6:33066046-33066068 GGCTGGGACTAGGGTGATGTAGG - Intronic
1006441526 6:34056505-34056527 GGCAGGGCCGGGCGGGCTCTAGG - Intronic
1006521190 6:34572167-34572189 GGCTGGGATCTGGGGCCTCTCGG + Intergenic
1006635046 6:35456007-35456029 GGCTGGGCCTGGGGGGCAGGAGG + Exonic
1006737569 6:36285370-36285392 GGATGGGACTGCGGGGCCCCAGG - Intronic
1007235667 6:40390028-40390050 GCCTGGGATTTGGAGGCTCTGGG + Intergenic
1007361081 6:41356305-41356327 TTCAGGGACTGGGGGGATCTGGG + Intergenic
1007514668 6:42401590-42401612 GGCAGGGCCTGGGGGTCTCATGG - Intronic
1007832126 6:44646745-44646767 GGCTGGTATTGAGGGGATCTTGG - Intergenic
1007958511 6:45938252-45938274 GTCAGGGGCTGTGGGGCTCTGGG + Intronic
1010123842 6:72410604-72410626 GCCTGGGGGTGGGGGGCACTTGG - Intergenic
1010507962 6:76684128-76684150 GCCTGGGATTGTTGGGCTCTGGG + Intergenic
1011684793 6:89815538-89815560 GGCTGGAGCAGGGGGGCTCTGGG - Intronic
1013475602 6:110504588-110504610 GGCTGCAACTGGGGGGTCCTTGG - Intergenic
1015567360 6:134587319-134587341 GCCTGAGACTGAGGGACTCTGGG + Intergenic
1016906773 6:149158674-149158696 GGGTGGGGGTGGGGGGTTCTAGG + Intergenic
1017325766 6:153140023-153140045 TGTGGGGACTGGAGGGCTCTAGG - Intergenic
1017888720 6:158621980-158622002 GGCTGGCTCTGAGGGGCGCTTGG - Intronic
1018240310 6:161767757-161767779 GGCTGGGGGTGGGGGGCTGGGGG + Intronic
1019104792 6:169659587-169659609 GGCTGTGTGTGGTGGGCTCTGGG - Intronic
1019363098 7:616080-616102 GGCTGGGCCTGGGAGGGTCTCGG - Intronic
1019550863 7:1601950-1601972 GGGTGACACAGGGGGGCTCTGGG - Intergenic
1019599619 7:1874763-1874785 GGGTGGGGCTGGAGGGCTCCAGG + Intronic
1019703626 7:2487323-2487345 GGGTGGGAGTGGGAGGCTCTTGG + Intergenic
1019744026 7:2689476-2689498 GGCTGGAACTCGGGTGCTCTGGG + Intronic
1019811076 7:3165501-3165523 TGCTTGGTCTGGGTGGCTCTGGG + Intronic
1019958589 7:4437180-4437202 GGCTGGTACAGTGGTGCTCTGGG + Intergenic
1020110179 7:5443456-5443478 GGATGGAAGGGGGGGGCTCTGGG - Intronic
1020282432 7:6656290-6656312 AGGTGGGCTTGGGGGGCTCTGGG + Exonic
1021246367 7:18267429-18267451 GGAAGAGACTGGGGAGCTCTTGG - Intronic
1021606601 7:22414831-22414853 GGCTGGCACAGTGGGGCTCGGGG + Intergenic
1021627826 7:22611969-22611991 GGCTGGGAGTGGGGGTGTCAGGG - Intronic
1021841659 7:24726135-24726157 GGCTGGGCCTGGGGAGCTGATGG - Intronic
1021917112 7:25444644-25444666 GGCTGGGAGTGGGGCGCCTTTGG + Intergenic
1022468115 7:30665025-30665047 GGCTATACCTGGGGGGCTCTGGG - Intronic
1022518337 7:30989525-30989547 TGCGGGCACTGAGGGGCTCTGGG - Intronic
1022815664 7:33912017-33912039 GGCTTGGACTGGGCTGATCTAGG + Intronic
1023804361 7:43861265-43861287 GGCTGCAACTGGGGGGTCCTCGG + Intergenic
1024202207 7:47118960-47118982 GGCTGGGGCTGGGGAGATGTTGG - Intergenic
1025698041 7:63790154-63790176 GGCTGGGGCTGGGGAGCGCGCGG + Intergenic
1026819135 7:73535006-73535028 GGCTGGCAGTGGCGGGATCTCGG - Intergenic
1026828821 7:73599624-73599646 GGCTGAAGCTGGGGGGCTCTGGG + Exonic
1028932251 7:96426569-96426591 GGCTGGGCCTGGGGCCCTTTTGG - Intergenic
1029109386 7:98204734-98204756 GGCTGAGGCAGAGGGGCTCTGGG + Intronic
1030837903 7:114311523-114311545 GGTTTGCACTGGGGGACTCTTGG - Intronic
1031528528 7:122850227-122850249 AGCTGGGTCAGGGGGCCTCTGGG - Intronic
1032087161 7:128890525-128890547 GGCAGGGGCTGGGGGGCCGTGGG + Intronic
1034043252 7:147901104-147901126 GGCTGGGACTGTTGGGATTTAGG - Intronic
1034311779 7:150094963-150094985 GGTGGGGGCTGGGGGGCTGTGGG - Intergenic
1034338306 7:150337432-150337454 GGCTGGGCCTCGGTGGCTCTGGG - Exonic
1034433132 7:151050838-151050860 GGCTGGGGCTGGGGGAGCCTAGG - Exonic
1034795075 7:154005691-154005713 GGTGGGGGCTGGGGGGCTGTGGG + Intronic
1035525256 8:307456-307478 AGCTGGGACTGGAGGACCCTGGG + Intergenic
1035546186 8:483891-483913 GTCGGGGTCTGGGGTGCTCTTGG - Intergenic
1035987737 8:4453354-4453376 TGCTGGGATTGGGGGTCTCCTGG + Intronic
1036406829 8:8462602-8462624 GGCTGTGAATTTGGGGCTCTTGG + Intergenic
1036481104 8:9140409-9140431 GGCTGGGGCTGAGTGGCTTTTGG + Exonic
1036592671 8:10183188-10183210 GGCTGGGACTGAGGGAGTCAAGG - Intronic
1036695238 8:10969972-10969994 GGCAGGGTCTGTGGGCCTCTGGG - Intronic
1037656421 8:20887984-20888006 TGCTGGGCCTGGGTGTCTCTTGG - Intergenic
1038875295 8:31542100-31542122 GTCTGAGACTGGATGGCTCTTGG + Intergenic
1039885618 8:41652539-41652561 GGGTGGGGCTGGGGTGCTCCAGG + Intergenic
1039910221 8:41820613-41820635 GGCTGGGACTAGCTTGCTCTGGG - Intronic
1040850275 8:51894086-51894108 GACTGGGAGGTGGGGGCTCTAGG + Intronic
1040956013 8:52980629-52980651 GGCTGCAACTGGGGGGAGCTCGG + Intergenic
1041118765 8:54565704-54565726 AGCGGGGATTGGGGGGATCTGGG + Intergenic
1041347015 8:56909961-56909983 GTCTTGGGGTGGGGGGCTCTAGG + Intergenic
1044442770 8:92241118-92241140 GGCTGCAACTGGGGGGTCCTCGG - Intergenic
1044728101 8:95209202-95209224 GGATGGGACAGGGGGGCACCAGG - Intergenic
1045232153 8:100315952-100315974 GGCTGGAATTGGTGGGTTCTTGG + Intronic
1045379626 8:101610392-101610414 GGCTTGAACTGGGGGACCCTGGG + Intronic
1045852156 8:106715291-106715313 GGCTGTGACAGGGTGGCTCAGGG + Intronic
1048308073 8:133297316-133297338 TGCTGGGACTGCGAGGGTCTGGG - Exonic
1048354181 8:133640177-133640199 GGTTGGGGCTGGAAGGCTCTAGG - Intergenic
1048472642 8:134717312-134717334 GGCCTGGACTGGTGGGTTCTTGG - Intergenic
1048533193 8:135269472-135269494 GGCGGGGAATGGGGGGCGCGCGG - Intergenic
1049159286 8:141087043-141087065 GCCAGGCACTGGGGGGCCCTGGG + Intergenic
1049220050 8:141424993-141425015 GGCTGGGGCTGCAGGGCTCAGGG - Intronic
1049426576 8:142540559-142540581 GCCTGGGCCTGGGGGGAGCTTGG + Intronic
1049591470 8:143464839-143464861 GGCTGAGGCTGGGGGCCTCCTGG - Intronic
1049653943 8:143789594-143789616 GCCTGGGAGCGGGGAGCTCTGGG - Intergenic
1049675159 8:143885969-143885991 GCCTGGGAGAGGGGGGCTCCAGG - Intergenic
1049819024 8:144622922-144622944 GGCTGAGACTGGGAGGGTTTAGG + Intergenic
1051181777 9:14419141-14419163 AAGTGGGACTGGGGAGCTCTCGG + Intergenic
1052997128 9:34557091-34557113 GGCTGGGATGGGGGGGGTCAGGG + Intronic
1053167431 9:35854343-35854365 AGCTGGGACTGGGGCTGTCTGGG + Exonic
1053313620 9:37034945-37034967 GGATGGGACCTGGGGGCTTTAGG - Intergenic
1054927232 9:70601330-70601352 GGCTGGGAATGGGGGTATCATGG + Intronic
1056080762 9:83092277-83092299 GTCTGGAACTGGTGGGTTCTTGG + Intergenic
1056660296 9:88538221-88538243 GGCTGGTACTGAGTGTCTCTTGG + Intronic
1057043324 9:91863737-91863759 GGCTGGGCCTGGGGGGAGATAGG + Intronic
1057294842 9:93828785-93828807 GCCGTGGACTGGGGGGCTCCAGG + Intergenic
1057699332 9:97351727-97351749 TGCTGGTAGTGGGGGGCTGTGGG - Intronic
1057927882 9:99169218-99169240 AGCTGGGCTTGGGAGGCTCTGGG + Intergenic
1058418997 9:104817192-104817214 GGCTGGGGCTGGGTGGCTGCGGG - Intronic
1058699616 9:107589565-107589587 CTCTGGGGCTGTGGGGCTCTGGG - Intergenic
1059176700 9:112175066-112175088 GGCTGGGCCTCGAGGACTCTGGG - Intronic
1060349064 9:122841737-122841759 GGCTGGGCTTGGGTGGCTCACGG + Intergenic
1060399595 9:123340548-123340570 GGCAGGGAGTGGGGGGCCCTGGG - Intergenic
1060989825 9:127842082-127842104 GGCTGGGAGTGGGGGTCTCCTGG + Intronic
1061059831 9:128244891-128244913 GGCTGGGGTTGGGGGGTTCTCGG - Intronic
1061226249 9:129282763-129282785 GCCTTGGACTGGGGAGCTCAGGG - Intergenic
1061660674 9:132128192-132128214 AGCTGGGTCTGGGGGACTCGAGG - Intergenic
1061869663 9:133513938-133513960 GGCTGGGACTCCTGGGCTCCTGG + Intergenic
1062105232 9:134751500-134751522 GGCTGAGAGTGAGGGGCTCTGGG - Intronic
1062230701 9:135480037-135480059 GGCCGGGGCCGGGGGGCTCGGGG + Intronic
1062249561 9:135587420-135587442 CGCGGGGACAGGGGTGCTCTCGG + Intergenic
1062310007 9:135930408-135930430 GGTGGGGACTGGGGGGCTCCGGG - Intergenic
1062345063 9:136110731-136110753 GACGGGGAAAGGGGGGCTCTGGG + Intergenic
1062490493 9:136802942-136802964 GGCTGGCCCTGGGGGGCCCCCGG - Intronic
1062490546 9:136803078-136803100 GGCTGGCCCTGGGGGGCCCCCGG - Intronic
1062573086 9:137194485-137194507 GGCTGGGCCTGGAGGGCTTCGGG - Intronic
1062619363 9:137412586-137412608 GGCTGCTCCCGGGGGGCTCTGGG - Intronic
1062624279 9:137435899-137435921 GGCTGGCTCTTAGGGGCTCTGGG - Intronic
1186480919 X:9895555-9895577 GGCTGGCCCTGGGAGGCTCCTGG - Exonic
1187139237 X:16576691-16576713 GTCTGGAATTGGTGGGCTCTTGG - Intergenic
1189309912 X:40011947-40011969 GGGTGGGAGTGGAGGGCGCTGGG - Intergenic
1190057683 X:47191166-47191188 GGCAGGGTTTGGGGGGCTTTGGG + Intronic
1190064636 X:47231482-47231504 GGCTGGGAAAGGAGGTCTCTTGG + Intergenic
1190108330 X:47574190-47574212 GGCTGGGCCTGGGGGTTTCTGGG + Exonic
1190274408 X:48891200-48891222 AGCTGGGGCTGGGGCGCCCTGGG - Intergenic
1190326755 X:49211259-49211281 GGCTGGCCCTGAGGGGCTCAGGG - Intronic
1192155490 X:68743476-68743498 GGCTGAGGCTGTGGGGGTCTGGG - Intergenic
1193159209 X:78208808-78208830 GGTTGGGGGTGGGGGGCTATGGG + Intergenic
1193314347 X:80046686-80046708 GGCTGCAACTGGGGGGTTCTCGG - Intergenic
1193580568 X:83258632-83258654 GCCTGGGACTCTGGGACTCTGGG + Intergenic
1195914710 X:109924747-109924769 GGCTGGGACTGGGGTGAGCAAGG - Intergenic
1196825250 X:119735571-119735593 GGATGGGACTTCGGGGCTCCTGG - Intergenic
1197571485 X:128156211-128156233 GTCTGGGGCTTGAGGGCTCTTGG + Intergenic
1197707814 X:129646888-129646910 GGCTGGGGCTGGGGGTGGCTGGG - Exonic
1197748995 X:129952343-129952365 GGCTTGGAGTGGGGGACTGTAGG + Intergenic
1198226120 X:134647462-134647484 GGCTGAGGCTGGGGGACACTCGG - Intronic
1198761632 X:140038827-140038849 GCCTGGAACTGGGGGGCTTCGGG - Intergenic
1198871047 X:141177238-141177260 GGCTGGGAGTGGGGGGGCCGCGG + Intergenic
1199599248 X:149531977-149531999 GGCTTGCCCTGGTGGGCTCTTGG - Intronic
1200247936 X:154535774-154535796 GGCTGGTAATGGGGGTCTCAAGG + Intronic
1202281949 Y:23199011-23199033 GGCATGGACTGCGGGGCTCTGGG + Exonic
1202283942 Y:23219508-23219530 GGCATGGACTGCGGGGCTCTGGG - Intronic
1202433621 Y:24813396-24813418 GGCATGGACTGCGGGGCTCTGGG + Exonic
1202435618 Y:24833894-24833916 GGCATGGACTGCGGGGCTCTGGG - Intronic