ID: 1081620863

View in Genome Browser
Species Human (GRCh38)
Location 11:44618555-44618577
Sequence TGGGACTGGGGGGCTCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620853_1081620863 -2 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620863 11:44618555-44618577 TGGGACTGGGGGGCTCTCGGTGG 0: 1
1: 1
2: 0
3: 22
4: 283
1081620852_1081620863 -1 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620863 11:44618555-44618577 TGGGACTGGGGGGCTCTCGGTGG 0: 1
1: 1
2: 0
3: 22
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620863 Original CRISPR TGGGACTGGGGGGCTCTCGG TGG Intronic
900178835 1:1302615-1302637 TGGGTCTGGGTGGCCCCCGGGGG - Intronic
900289408 1:1917544-1917566 TGGGACTCCAGGGCTCTGGGAGG - Intergenic
900512961 1:3069028-3069050 CGGGATTGGGGGGCTCTCCTCGG - Intergenic
900520230 1:3101862-3101884 TGGGACTGGGGGTCTCCGGGTGG - Intronic
900968208 1:5974271-5974293 TGGGGCTGGTGCGCTCTGGGAGG + Intronic
902547706 1:17200208-17200230 GGAGACTGGGGGGTTGTCGGGGG + Intergenic
902809041 1:18877937-18877959 TGGGAATGGCTGGCTCTCGGGGG - Intronic
903071853 1:20730632-20730654 TTGGGGTGGGGGGCTCCCGGGGG + Intronic
903173134 1:21565749-21565771 GGGGACTGGGAGGCTTTTGGGGG - Intronic
903769433 1:25754534-25754556 AGGGAGGGGGGTGCTCTCGGGGG + Intronic
904257074 1:29260602-29260624 TGGGAGTTGGGGGCTCTGCGAGG - Exonic
904315033 1:29654396-29654418 TGGGTCTGGAGGGCACTCAGAGG + Intergenic
904353296 1:29922740-29922762 TGGGTCTGGAGGGCACTCAGAGG + Intergenic
904541884 1:31239157-31239179 TGGGACTGGGGGTGTGTCTGAGG - Intronic
904676261 1:32201028-32201050 TGGGACTGGGGGGGTTGGGGGGG - Intronic
905201456 1:36319745-36319767 TGGAGCTGGGGGCCTCTCTGGGG - Exonic
905858033 1:41327759-41327781 TGGTACTGGGGGGAGCTAGGGGG + Intergenic
905923250 1:41732843-41732865 TGGGACTGGGGGTCGGTAGGAGG + Intronic
906319953 1:44809589-44809611 TGGGACTAAGAGGCTCTAGGAGG + Intronic
906536020 1:46551394-46551416 TGGGACTGGGGGGCCCGTAGTGG - Intronic
906891018 1:49715108-49715130 TGGGGCTGGGGGGCTAGGGGAGG - Intronic
907260634 1:53215965-53215987 TGAGACTTGGGGGCTTTGGGAGG - Intronic
912413335 1:109492344-109492366 TGGGACGGGGGTGCTCTCCTGGG + Intronic
912471210 1:109908202-109908224 TGGGGCTGGGGGGCTTGCGGAGG + Intergenic
913130433 1:115834044-115834066 TGGGAGTGGGGGACTCTGGAGGG - Intergenic
913319511 1:117578515-117578537 TGGCACTGGGGAACTCTGGGAGG - Intergenic
913586137 1:120277550-120277572 TGGGCCTGGGAGGCTCCAGGAGG + Intergenic
913622049 1:120620819-120620841 TGGGCCTGGGAGGCTCCAGGAGG - Intergenic
914568146 1:148889408-148889430 TGGGCCTGGGAGGCTCCAGGAGG + Intronic
914604678 1:149240841-149240863 TGGGCCTGGGAGGCTCCAGGAGG - Intergenic
914899834 1:151706049-151706071 TGGGACTGGAGGGCACTCCCAGG - Intronic
915264779 1:154709067-154709089 GGGTACTGGGGAGCTCTCAGGGG - Intronic
916716745 1:167452802-167452824 TGGCGTTGGGGGGCTCTTGGTGG - Intronic
920030456 1:203034541-203034563 TGGGAGTGGGGGGCAGTGGGGGG + Intronic
920255473 1:204651600-204651622 TGGGGCTGGGGGGTTTTGGGGGG - Intronic
922234667 1:223713503-223713525 GGGGTCTGGAGGGCTCCCGGAGG - Intronic
922808259 1:228401660-228401682 GGGGTCTGGGAGGCTCTGGGTGG - Intronic
924798489 1:247309990-247310012 TGGGCTTGGGGGTCTCTCTGAGG + Intronic
1062925023 10:1309751-1309773 TGGGAGGGAGGGGCTCTCTGGGG + Intronic
1063449942 10:6144713-6144735 CGGGACCGGGGGGATCTGGGCGG + Intergenic
1066484294 10:35828525-35828547 TAGGGCTGGGGGGCTCTTGGTGG + Intergenic
1069534274 10:69241436-69241458 AGGCACTGGGGGACTCTGGGTGG + Intronic
1069633628 10:69912537-69912559 TGGGGGTGGGGGGCGGTCGGTGG - Intronic
1069929381 10:71872361-71872383 TTGGACTAGGGTGCTCTCTGAGG - Intergenic
1069984461 10:72273963-72273985 CGGGTCTGGGCGGCTCTCGGTGG + Exonic
1070277554 10:75022002-75022024 TGTGACTGGCCGGCTCTCCGGGG - Exonic
1071568248 10:86682491-86682513 TGGGACTGGGGCACTGTAGGGGG + Intronic
1072393758 10:95017276-95017298 TGGGAGTGGGGGGCTGAAGGAGG - Intergenic
1073974733 10:109087485-109087507 TGGGACAGGTGGGCTCTGGAAGG - Intergenic
1076787785 10:132759644-132759666 AGGTGGTGGGGGGCTCTCGGGGG + Intronic
1076887568 10:133269625-133269647 AGGGACCGAGGGGCCCTCGGGGG - Intronic
1077065914 11:640872-640894 CGGAACTGAGTGGCTCTCGGGGG - Intergenic
1077284736 11:1760653-1760675 TGGGCCAGGGGGGCCCTGGGGGG - Intronic
1079316098 11:19409009-19409031 GGGGAGAGGGGGGCTCTTGGAGG + Intronic
1079340054 11:19604295-19604317 TTGGACTGGGGGGGCATCGGTGG + Intronic
1081620863 11:44618555-44618577 TGGGACTGGGGGGCTCTCGGTGG + Intronic
1082835136 11:57645967-57645989 TGGGACTGAGGGGCTCAGGCAGG - Exonic
1083325681 11:61871889-61871911 TGGGGCTGGGTGGCACCCGGAGG + Intergenic
1084681260 11:70667754-70667776 TGGGCCTGAGGGGCTCTGGGTGG + Intronic
1084789084 11:71462145-71462167 TGGGAGTGGGGGGTGATCGGGGG + Intronic
1085333226 11:75669630-75669652 AGGGACTGGGCGGTTCTTGGGGG - Intergenic
1089261144 11:117224808-117224830 TGAGACTGGGAGGCGCTGGGTGG - Intronic
1091906675 12:4194933-4194955 TGGGACTGGGGGGCTTTCCAAGG - Intergenic
1094064737 12:26350700-26350722 TGGGCCAGGTGGGTTCTCGGGGG - Intronic
1096534431 12:52262331-52262353 GGGGGCTGGGGGGCTCTGGATGG - Intronic
1096693758 12:53336118-53336140 TGACACTGGGGAGCTCTGGGAGG - Intronic
1098683363 12:73386218-73386240 TGGGAGTGGGGGGCTAGGGGAGG + Intergenic
1100404758 12:94263480-94263502 GGGGCCAGGTGGGCTCTCGGGGG - Intronic
1102010946 12:109618000-109618022 TGGGCCTGGAGGGGTCTGGGAGG + Intergenic
1102571045 12:113827308-113827330 CAGGACTGGGGGGTTGTCGGGGG - Intronic
1102734156 12:115143168-115143190 AGGGGCTGGGGAGCTCTCTGGGG - Intergenic
1104047356 12:125172788-125172810 AGGGGCTGGTGGGCACTCGGTGG + Intergenic
1104636281 12:130439696-130439718 TGGGTCTGTGGGGGTGTCGGTGG + Intronic
1104934225 12:132355962-132355984 GGGGACTGGTGGGCTCAGGGTGG - Intergenic
1105327664 13:19384610-19384632 TGGGATTGTGGGGCTCCTGGGGG + Intergenic
1105673198 13:22642909-22642931 TGGGACTGGGAGGATCTCACTGG + Intergenic
1106542556 13:30703329-30703351 GGGGCCTGGGAGGCTTTCGGCGG + Intergenic
1107932347 13:45316503-45316525 TGGGGCTGCAGGGGTCTCGGAGG + Intergenic
1112393766 13:99009652-99009674 GGGGACAGGTGGGATCTCGGGGG - Intronic
1112437073 13:99398241-99398263 GTGGGCTGGGGGGCTCGCGGTGG - Intergenic
1115311729 14:31985024-31985046 AGGGACTGTGGGGCTCCCTGTGG + Intergenic
1118046181 14:61974050-61974072 TGGGCCTGGGGGGCTGTGGTGGG + Intergenic
1118984753 14:70744193-70744215 TGGGAGTGGGGGGCTAGGGGAGG + Intronic
1119169486 14:72523382-72523404 TGGGGCTCAGGGGCTCTGGGTGG + Intronic
1119325129 14:73755303-73755325 TGGGGCTGGGGGTCTCCCTGAGG - Intronic
1119541179 14:75439082-75439104 TGAGCCTGGGGGGAGCTCGGAGG + Intronic
1119910498 14:78345532-78345554 AGGGACTTGGGGGCTCCCAGAGG + Intronic
1122269895 14:100564145-100564167 AGGGTCTCGGGGGATCTCGGGGG + Intronic
1122325502 14:100878978-100879000 TGGGGCGGGGGTGCTCTGGGAGG + Intergenic
1122883158 14:104699131-104699153 TGGGGCACGGTGGCTCTCGGCGG + Intronic
1122929592 14:104927232-104927254 TAGGACTGGGGGGCCCCAGGGGG + Intronic
1202841392 14_GL000009v2_random:124705-124727 TGGGCCTCGGGGGATCCCGGGGG - Intergenic
1202910781 14_GL000194v1_random:114936-114958 TGGGCCTCGGGGGATCCCGGGGG - Intergenic
1202881835 14_KI270722v1_random:67722-67744 TGGGCCTCGGGGGATCCCGGGGG + Intergenic
1124473216 15:30007370-30007392 TGGGGCTGGGGGGTTCATGGTGG + Intergenic
1125104005 15:35949649-35949671 TGGGGGTGGGGGGCTAGCGGAGG + Intergenic
1126100644 15:45116419-45116441 TGGGGGTGTGGCGCTCTCGGCGG - Intronic
1128092969 15:64931421-64931443 TGGGATTGGGGGTCACTTGGGGG + Intronic
1128620070 15:69141434-69141456 TGGCACTGAGGGGCTCTTGTGGG - Intergenic
1132534443 16:471164-471186 TGGGAGTTGGGGGCCCTGGGGGG - Intronic
1132591339 16:727653-727675 GGGGTCGGGGAGGCTCTCGGGGG - Intronic
1133232177 16:4372005-4372027 TGGGGCTGGGGGGCTGCGGGCGG + Intronic
1135342978 16:21664408-21664430 TGGGATTGGAGGGCACTTGGAGG + Intergenic
1136064889 16:27751932-27751954 TGGAGCTGGGGGGCTGTGGGGGG + Intronic
1136511279 16:30739505-30739527 GGGGACTTGGGGGCTGTAGGCGG - Exonic
1137469107 16:48738713-48738735 TGGGGCTGGGAGGCTCTGGAGGG + Intergenic
1138551987 16:57753271-57753293 AGGGCCTGGGGGGCCTTCGGGGG + Intronic
1139482032 16:67236045-67236067 GGGGACGGGTGGGCTCTCAGGGG + Intronic
1140321336 16:73954678-73954700 TGGGACATGGAGGCTCTCAGGGG - Intergenic
1142148500 16:88502554-88502576 AGGGACAGTGGGGCTCTGGGAGG - Intronic
1142590620 17:1004044-1004066 TGGGGCTGTGGGGCTCCCTGAGG + Exonic
1143204769 17:5134002-5134024 TGGGACTGTGTGGCTCCCGTAGG - Intronic
1145254279 17:21314257-21314279 TGGGGCTGTGGGGCTCTGGAGGG - Exonic
1145754356 17:27380094-27380116 TGGGTGTGGGTGGCTCTCAGAGG + Intergenic
1146716257 17:35089220-35089242 TGGGGCTGAGGGGCACCCGGGGG + Exonic
1147551414 17:41445180-41445202 TGGGACCGTGGGGCCCTGGGGGG - Intergenic
1147862841 17:43533612-43533634 TGGGACAGTGGGCCTCTTGGTGG + Intronic
1148351340 17:46943967-46943989 TAGGAAGAGGGGGCTCTCGGAGG + Intronic
1150010031 17:61494833-61494855 TGGCAGTGGGGGGCGCTCAGAGG - Intergenic
1151605093 17:75130941-75130963 TGGGGGTGGGGGGCTCTCAAGGG - Intronic
1152082491 17:78196896-78196918 AGGGACTGGAGGGCCCTCTGTGG + Intronic
1152088928 17:78236484-78236506 TGGGACTGGGGGGCCCTCGGAGG - Intronic
1152444599 17:80334249-80334271 TGGGTCCGGGAGGCTCTTGGAGG + Exonic
1153474870 18:5488413-5488435 GGGGACTGGGGGGCTAGGGGAGG + Intronic
1153773533 18:8433790-8433812 TGGGGTTGGGGGGCTCTGAGTGG + Intergenic
1155570264 18:27185091-27185113 TGGGGCTGGGGGGCACTGGAGGG - Intronic
1161535493 19:4816565-4816587 TGGGACTGGGGCGCCCTATGGGG - Exonic
1161689162 19:5720828-5720850 TGGGGCTGGGGTGCTGCCGGGGG + Intronic
1161993776 19:7699913-7699935 TGGGACTTGGTGGCACTCAGGGG + Intronic
1162803616 19:13124678-13124700 AAGGACTGTGGGGCTCTCTGGGG + Intronic
1163359407 19:16836447-16836469 AGGGACTAGGGGGCTCTCTGTGG - Intronic
1163571826 19:18086829-18086851 TGGGGCTGTGGGGCTCTACGTGG - Exonic
1164513922 19:28918260-28918282 TGGGCCTGGAGGGATCTCTGGGG + Intergenic
1164581941 19:29440042-29440064 TGGGGCTGCGCGGCTCTCGGGGG + Intergenic
1166122250 19:40692818-40692840 GGGGACTGGGGGACTCTAGGAGG - Intronic
1166539665 19:43596667-43596689 TGGGAGGCGGGGGCTCTGGGCGG + Exonic
1166947876 19:46408378-46408400 TGGGGGGGGGGGGGTCTCGGGGG - Intergenic
1168184844 19:54693644-54693666 TGGGGCTGGGGGGCTGGGGGAGG - Intronic
1168669374 19:58229280-58229302 TGGGACTGGGTGGGACTGGGTGG + Intronic
1168669378 19:58229290-58229312 TGGGACTGGGTGGGACTGGGTGG + Intronic
1168669382 19:58229300-58229322 TGGGACTGGGTGGGACTGGGTGG + Intronic
925020247 2:562925-562947 TGGGCCTGCGGGGCTGTGGGGGG + Intergenic
925020260 2:562964-562986 TGGGCCTGCGGGGCTGTCGGGGG + Intergenic
926049887 2:9737803-9737825 TGGAAGTGGGGGGCACTAGGAGG - Intergenic
926416586 2:12655437-12655459 TGGGACTGTGGGGCTCACATCGG - Intergenic
927142452 2:20139733-20139755 TGGGGGTGGAGGGCTCTGGGAGG - Intergenic
929452562 2:42047478-42047500 TGGGACTGGGGGCCTCGGGGCGG - Intergenic
929990571 2:46782730-46782752 TTGGCCTGGGTGGCTCTCGTGGG - Intergenic
931720150 2:65061635-65061657 GGGGACTGTGGGGCTCCAGGGGG + Intronic
933948570 2:87308948-87308970 TGGGGGTGGCGGGCTCTTGGGGG + Intergenic
936242419 2:110799389-110799411 TGAGACTTGGGGGCTCTCAGGGG + Intronic
936331629 2:111552647-111552669 TGGGGGTGGCGGGCTCTTGGGGG - Intergenic
936521087 2:113212564-113212586 GGGAAGTGGGGGGGTCTCGGAGG + Intergenic
938107732 2:128544711-128544733 TGGAAGGGGGGGGCTCTCGGGGG + Intergenic
938369813 2:130762122-130762144 TGGGTCTGGGGGTTTCTCGTGGG - Exonic
940205247 2:151195263-151195285 TGGTATTGGGGGGCTGTCGAGGG + Intergenic
941188199 2:162343949-162343971 AGGGACTGGAGGGCTCCCGATGG + Intronic
942155330 2:173121771-173121793 TGGGAATGGGGGACTGTCAGGGG + Intronic
944019142 2:195079618-195079640 TGGGGCTGGGGGGCTGGGGGAGG + Intergenic
946962031 2:224995623-224995645 TTGGACTGGGTGGCTCTCCATGG - Intronic
947823680 2:233089944-233089966 AGGGACTGGGCGCCTCTCAGAGG - Intronic
947910668 2:233798868-233798890 TGGAAATGGGGGGCACTCAGGGG + Intronic
948396974 2:237652025-237652047 TGGCACTGGGAGGCCCTCAGTGG + Intronic
948710445 2:239821855-239821877 TGGGAAAGGGGGGCTCTGGCTGG + Intergenic
948882808 2:240869032-240869054 TAGGAGTGGGGGTCACTCGGGGG + Intronic
1170630189 20:18058544-18058566 TGGGGTGAGGGGGCTCTCGGGGG - Intronic
1171767978 20:29300657-29300679 TGGGCCTGGTGGGCGCCCGGAGG - Intergenic
1171768286 20:29301788-29301810 GGGGACGGGGGAGCTCTTGGGGG - Intergenic
1172513037 20:35513852-35513874 TGGAGCTGGGGGGCTCTTGAGGG - Exonic
1172699760 20:36845835-36845857 TGGGGGTGGGGGGCCCTGGGAGG + Intronic
1173664750 20:44755936-44755958 TGGGAGAGGGGAGGTCTCGGGGG + Exonic
1173873729 20:46357142-46357164 TGGGACTGGTTGGCCCTGGGAGG - Intronic
1175951223 20:62584403-62584425 TGGGACTTGGGTGCCCTCTGGGG + Intergenic
1176014915 20:62926154-62926176 GGGGACTGGCGAGCACTCGGTGG - Intronic
1176024539 20:62978931-62978953 AGGGACGGGGGGACCCTCGGAGG + Intergenic
1176040152 20:63060924-63060946 TGGGGGTGGGGGGCTCTGGCAGG + Intergenic
1176132456 20:63502065-63502087 TGGGTCCTGGGGGCTCTGGGAGG - Intergenic
1176413256 21:6460113-6460135 TGGGCCTGGGGGGTCCTGGGGGG - Intergenic
1176512746 21:7760872-7760894 AGGGACTCTGGGGCTCTCCGTGG - Intronic
1176630134 21:9129633-9129655 TGGGCCTCGGGGGATCCCGGGGG - Intergenic
1177051877 21:16246688-16246710 GAGGACTGGAGGGCTCTCTGGGG + Intergenic
1178143657 21:29714460-29714482 TGGGACTGGGTGGCTTTCCAGGG + Intronic
1178646859 21:34391396-34391418 AGGGACTCTGGGGCTCTCCGTGG - Intronic
1179442399 21:41404253-41404275 AGGGACTGCGGGGCTCTCCAAGG + Intronic
1179531398 21:42022023-42022045 TGGGTCTGGGGGGGTCTCTCTGG + Intergenic
1179633178 21:42691196-42691218 TGGGACTGGGTGACTCTGGATGG - Intronic
1179688753 21:43068435-43068457 TGGGCCTGGGGGGTCCTGGGGGG - Intronic
1179993116 21:44958816-44958838 TGGGGCTGGGGAGCTCCCTGGGG + Intronic
1180174871 21:46082610-46082632 CGGGACTGGGAGGGTCTCTGGGG - Intergenic
1180376447 22:12098017-12098039 TGGGCCTCGGGGGATCCCGGGGG + Intergenic
1183450707 22:37893339-37893361 GGGGAATGGGGAGCTCTGGGTGG + Intergenic
1184943429 22:47784600-47784622 TGGGGCTGGGGGGCCCTCCTGGG + Intergenic
949362309 3:3244733-3244755 TGGGATTTGGGGGCTCACTGTGG + Intergenic
950041672 3:9923770-9923792 CTAGACTGGGAGGCTCTCGGAGG - Intronic
950288247 3:11762105-11762127 TGGGCCTGCAGGGCTCTGGGTGG - Intergenic
950454172 3:13082852-13082874 TGGGAGTGGGGGGCTGACAGTGG - Intergenic
950498292 3:13347575-13347597 TGTCTCTGGGGGGCTCTCTGGGG - Intronic
951041785 3:17995959-17995981 TGGGGCTGGAGGCCTCTGGGTGG + Intronic
951512891 3:23523963-23523985 TGGGGTTGGGGGGTTCTCCGTGG + Intronic
951811374 3:26704041-26704063 TGGAACTGAGGGGCTGTCAGGGG - Intronic
954057140 3:48036296-48036318 TGGGATTGGGTGGCTGTGGGTGG - Intronic
954836735 3:53476391-53476413 AGGGAGTGGGGGGCTCAGGGAGG - Intergenic
960640358 3:119817233-119817255 TGGGTCTGGCTGCCTCTCGGAGG - Exonic
961109160 3:124268945-124268967 TGGATGTGGAGGGCTCTCGGCGG + Exonic
961260146 3:125595519-125595541 TGGGGCTGTGGGGCTGTGGGTGG - Intergenic
961591136 3:127982739-127982761 TGGGACAGGGGAGCTGTCTGGGG - Intronic
961645402 3:128390205-128390227 TGGGACTTGGGGTCACTCAGTGG + Intronic
963919457 3:150891874-150891896 TGTGACTGGGGGGCTCAGGAAGG + Intronic
965093518 3:164192984-164193006 TGGGACTGTGGGGCTCCCCATGG - Intergenic
966568221 3:181407704-181407726 TGGGAGTGGGGGGCTAGGGGAGG + Intergenic
968471282 4:783489-783511 TGGGACTGGGCAGCTCCCTGGGG + Intergenic
968554079 4:1238585-1238607 GGGGACTTGGAGGGTCTCGGAGG - Intronic
968554094 4:1238627-1238649 AGGGTCTGGGAGGATCTCGGAGG - Intronic
968617150 4:1582556-1582578 TCGGGCTGGGTGGCTCTCTGAGG - Intergenic
968621287 4:1604507-1604529 TGTGAGTGGGGGGCTCCCTGGGG - Intergenic
969228640 4:5814908-5814930 TGGGACTGGGGTGAGGTCGGTGG + Intronic
969378068 4:6776301-6776323 TGGAACTGGTGGGCTCCCTGTGG - Intergenic
969437237 4:7195061-7195083 TGGGGGTGGGGGGCTGTCAGAGG + Intronic
969574701 4:8030138-8030160 AGGGACTGGGGGAGTCTCCGTGG - Intronic
975892884 4:79050291-79050313 TGTGACTGCGGTGGTCTCGGGGG + Intergenic
978092770 4:104738290-104738312 TGGGAATGAGGGGGACTCGGTGG + Intergenic
984329627 4:178298072-178298094 TGGGGCGGGGGGGCAGTCGGAGG + Intergenic
985016247 4:185638714-185638736 GGGCATTGGGGGGCTCTCAGGGG + Intronic
1202758047 4_GL000008v2_random:83450-83472 TGGGCCTCGGGGGATCCCGGGGG + Intergenic
985928053 5:3033362-3033384 TGGAACTGGTGGGCTATCTGGGG + Intergenic
990719042 5:58672467-58672489 TGGGACTGGATGGTTCTCGAAGG + Intronic
992784430 5:80156031-80156053 TGGGGCTTGGGGGCTCTGGAGGG + Intronic
992962740 5:81972145-81972167 TGGGACTGCGGGGGCCTCGAGGG - Exonic
994451539 5:99950460-99950482 GGGGACTGGGGGGCTGAGGGCGG + Intergenic
995379059 5:111512254-111512276 TGGATCTGGGGAGCTCGCGGTGG - Intronic
995841476 5:116447016-116447038 TGAGACAGGGAGGCTCCCGGGGG + Exonic
996421729 5:123270100-123270122 TGGGTCTGGTTGGCTCTGGGAGG - Intergenic
998836077 5:146203860-146203882 TGGGCGTTGGGGGCTCGCGGGGG + Intronic
1001567018 5:172706464-172706486 TGGGACTTGGGGCCTTTGGGAGG + Intergenic
1002081201 5:176738487-176738509 TGAGCCTGGGGAGCTCTAGGGGG - Intergenic
1002450628 5:179316475-179316497 TGGGGCTGGGGAGCCCTAGGGGG - Intronic
1003107534 6:3227720-3227742 GGGGACTGGGGGGCTCGGGCTGG - Exonic
1004971860 6:20919523-20919545 TGGGAGTGGGGGGCTAGGGGAGG - Intronic
1010933704 6:81835164-81835186 GGGGGCTGGGGGGCTATGGGAGG - Intergenic
1014743641 6:125174069-125174091 TGGAAATGGGGGGCCCTCGATGG + Intronic
1016401313 6:143683812-143683834 TGGGACTGGAGGATTCTGGGAGG - Intronic
1018963584 6:168466275-168466297 TGGAACTGGGGGGCTCTGAGTGG + Intronic
1018981682 6:168606503-168606525 TGGGACTGCTGGACTCTCTGGGG + Intronic
1019477084 7:1249346-1249368 TGGGACTGGGAGGAACCCGGGGG - Intergenic
1019528540 7:1492461-1492483 TGGGAATGGGGTTCTCTTGGGGG + Intronic
1020110178 7:5443453-5443475 TGGAAGGGGGGGGCTCTGGGTGG - Intronic
1022531470 7:31069603-31069625 TGTGGCTGGGGGGCTCCAGGGGG + Intronic
1023615810 7:42018060-42018082 TGGGCCTGGGGGGCTCTGGCCGG + Intronic
1024261019 7:47573771-47573793 TGGGATTTGGGGGCTCAAGGAGG - Intronic
1025174059 7:56787798-56787820 TGGGGCTGGGGAGCGCGCGGTGG - Intergenic
1025698042 7:63790157-63790179 TGGGGCTGGGGAGCGCGCGGTGG + Intergenic
1027215393 7:76180204-76180226 TGGGGTTGGGGGGCTCCCAGGGG - Intergenic
1027229760 7:76265300-76265322 GGGGGCTGGGGGGATCACGGGGG + Intronic
1029307622 7:99632010-99632032 GGGGACTGGGGAGGCCTCGGGGG + Exonic
1029440135 7:100582846-100582868 AGGGGCTGGGGGGCTCCCGGAGG + Intronic
1029833028 7:103280550-103280572 TGGGGCTGGGAGCCTGTCGGGGG - Intergenic
1030876294 7:114817410-114817432 TGGGAGTTGGGGGCTCGGGGAGG + Intergenic
1032216192 7:129959156-129959178 TGGAATTGGGGGGCTTTCTGGGG - Intergenic
1034676666 7:152897078-152897100 TGGGACTGCAGGGCTCTCACTGG + Intergenic
1035546185 8:483888-483910 GGGGTCTGGGGTGCTCTTGGTGG - Intergenic
1035783491 8:2246519-2246541 TGGCACTGGGAGGCTCTTGAGGG + Intergenic
1035808632 8:2473067-2473089 TGGCACTGGGAGGCTCTTGAGGG - Intergenic
1036137210 8:6173432-6173454 TGAGACTGGGGGACTCTCAACGG + Intergenic
1040681945 8:49821024-49821046 TGGGACTGGGAGGATTTGGGAGG + Intergenic
1041697197 8:60748423-60748445 TGGCACTGGAGGGCACTAGGAGG + Intronic
1043006934 8:74831479-74831501 TGTGACTGTGGTGCTCTGGGGGG + Intronic
1044725665 8:95192430-95192452 AGGGACTAGGGGTCTCTCTGGGG - Intergenic
1044865026 8:96562473-96562495 TGGGACTTGGTAGCTCTGGGGGG + Intronic
1047178522 8:122565370-122565392 GGGGGCTGGGGGGCTGGCGGAGG + Intergenic
1048308072 8:133297313-133297335 TGGGACTGCGAGGGTCTGGGAGG - Exonic
1048533192 8:135269469-135269491 GGGGAATGGGGGGCGCGCGGTGG - Intergenic
1049803748 8:144529858-144529880 GGGGCCTGGCAGGCTCTCGGTGG - Exonic
1051342123 9:16121304-16121326 TGGGACGGGGTGGCTGTGGGAGG + Intergenic
1053167432 9:35854346-35854368 TGGGACTGGGGCTGTCTGGGTGG + Exonic
1055930871 9:81558815-81558837 TGGGACAGGGAGGCACACGGGGG - Intergenic
1060161362 9:121368651-121368673 TGGCACTGGGGGGGTCGCGGTGG + Intronic
1060319019 9:122538137-122538159 GGGGACTGGGGGGCTGTTGGGGG - Intergenic
1061415671 9:130445585-130445607 TGGGGCTGGCGGCCTCGCGGCGG + Intronic
1061910753 9:133721632-133721654 TGGGACTTGGGGGCGTTAGGTGG + Intronic
1061948221 9:133920610-133920632 TGGGTCTGTGGGGCGCTCAGAGG - Intronic
1062310006 9:135930405-135930427 GGGGACTGGGGGGCTCCGGGAGG - Intergenic
1062312883 9:135948742-135948764 TGGGACTGGGTGGCTGGCTGGGG - Intronic
1062433118 9:136534875-136534897 AGGGACTGGGGGGCTCTGTGGGG - Intronic
1062433128 9:136534898-136534920 AGGGACTCGGGGGCTCTGTGAGG - Intronic
1062433144 9:136534943-136534965 AGGGACTGGGGGGCTCTGTGGGG - Intronic
1062532776 9:137009162-137009184 TGGGGTTGGGGGGCTGTGGGAGG - Intronic
1062732214 9:138116455-138116477 TGGGAATGGGGGGCTGCCAGCGG - Intronic
1203689657 Un_GL000214v1:30470-30492 TGGGTCTCGGGGGATCCCGGGGG + Intergenic
1203752968 Un_GL000218v1:97318-97340 TGGGCCTCGGGGGATCCCGGGGG - Intergenic
1203361316 Un_KI270442v1:220827-220849 TGGGCCTGGTGGGCGCCCGGAGG - Intergenic
1203538836 Un_KI270743v1:68322-68344 TGGGCCTCGGGGGATCCCGGGGG + Intergenic
1203646618 Un_KI270751v1:73583-73605 TGGGTCTCGGGGGATCCCGGGGG - Intergenic
1185543652 X:924186-924208 TGGGGCTGGAGGACTCTCTGTGG + Intergenic
1185622281 X:1457518-1457540 TGGGGCTGGAGGACTCTCTGTGG - Intergenic
1185736924 X:2501706-2501728 TGGTCCTGGGGGGCCCTGGGAGG - Intronic
1187048856 X:15675967-15675989 TGGGAGTGGGAGGCTGGCGGCGG + Intergenic
1192487483 X:71541817-71541839 TGGGGGTGGGAGGCTCTAGGAGG + Intronic
1193159210 X:78208811-78208833 TGGGGGTGGGGGGCTATGGGAGG + Intergenic
1195062766 X:101212499-101212521 AGGGACTGGGGGGATATTGGGGG + Intergenic
1195672532 X:107482002-107482024 TGGGACTTGGGGGCTCTACCTGG - Intergenic
1198871048 X:141177241-141177263 TGGGAGTGGGGGGGCCGCGGCGG + Intergenic
1201077132 Y:10196733-10196755 TGGGCCTGGTGGGCGCCCGGAGG + Intergenic
1201288974 Y:12404005-12404027 TGGGACTGGGGGGTTCCATGTGG + Intergenic
1202281950 Y:23199014-23199036 ATGGACTGCGGGGCTCTGGGAGG + Exonic
1202283941 Y:23219505-23219527 ATGGACTGCGGGGCTCTGGGAGG - Intronic
1202433622 Y:24813399-24813421 ATGGACTGCGGGGCTCTGGGAGG + Exonic
1202435617 Y:24833891-24833913 ATGGACTGCGGGGCTCTGGGAGG - Intronic