ID: 1081620865

View in Genome Browser
Species Human (GRCh38)
Location 11:44618568-44618590
Sequence CTCTCGGTGGTTCTGCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620853_1081620865 11 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620865 11:44618568-44618590 CTCTCGGTGGTTCTGCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1081620852_1081620865 12 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620865 11:44618568-44618590 CTCTCGGTGGTTCTGCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1081620861_1081620865 -4 Left 1081620861 11:44618549-44618571 CCGGGCTGGGACTGGGGGGCTCT 0: 1
1: 0
2: 2
3: 44
4: 393
Right 1081620865 11:44618568-44618590 CTCTCGGTGGTTCTGCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620865 Original CRISPR CTCTCGGTGGTTCTGCATGG CGG Intronic
900606904 1:3527775-3527797 CTCTCGGGGGTCTTGGATGGAGG - Intronic
900865536 1:5266247-5266269 CTTCAGGCGGTTCTGCATGGAGG + Intergenic
900975636 1:6014595-6014617 CTCTCTGTGGTGCTGCTTGCCGG - Intronic
902491641 1:16786637-16786659 CTCTCCGTGGGCCGGCATGGAGG - Intronic
906331074 1:44884842-44884864 CTCTCGAAGGTTCTGCCTGATGG - Intronic
910087498 1:83420600-83420622 CTCGTGGTGGTGCTGCTTGGTGG - Intergenic
919867151 1:201791049-201791071 TTACCAGTGGTTCTGCATGGAGG + Intronic
920080705 1:203371011-203371033 CATTCAGTGGTTCTGCATAGGGG + Intergenic
920922796 1:210312001-210312023 GTCACGGTGGTACTGCAGGGTGG - Intergenic
923155932 1:231279449-231279471 CTCTAGGTGGCTGGGCATGGTGG + Intergenic
923290395 1:232539698-232539720 CTCTAGCTGGTTCTGGAGGGTGG - Intronic
923528805 1:234795905-234795927 CTCTCCGTGGGCCGGCATGGAGG + Intergenic
1070290506 10:75110674-75110696 CTCAGGGTGGTGCAGCATGGTGG + Intronic
1071792511 10:88970286-88970308 TTCTGGGTGGTTCTGGAAGGTGG - Intronic
1073786693 10:106897765-106897787 CACTCTGTGGCTCTGCATAGTGG - Intronic
1074726457 10:116315174-116315196 CTGTGGGTAGTTCTGCCTGGTGG + Intergenic
1075567062 10:123512512-123512534 CTCGCTGTGGCTCTCCATGGTGG + Intergenic
1077467482 11:2740456-2740478 CTCTGGGTGGGGCTGCATCGGGG - Intronic
1081620865 11:44618568-44618590 CTCTCGGTGGTTCTGCATGGCGG + Intronic
1083841904 11:65309354-65309376 CTCTGGGTGTTTCTCCATCGTGG + Intergenic
1086421634 11:86643359-86643381 TTGTGGGTGGTTCTGAATGGAGG - Intronic
1088607000 11:111541610-111541632 CTTTCAGTTGTTCTGCATGTCGG + Intronic
1089211600 11:116807778-116807800 CCCTCGGTCCTCCTGCATGGAGG - Intergenic
1095180616 12:39143721-39143743 GTATCCGTGGTTCTGCATTGTGG - Intergenic
1098909602 12:76195534-76195556 CTCTCTTTGGGTCTGAATGGAGG - Intergenic
1101341582 12:103846810-103846832 CTCTCTGTGGCTCTGCTTCGTGG + Intergenic
1102746994 12:115258079-115258101 CTCTCCATGGTTCTGTATTGCGG + Intergenic
1104954959 12:132459836-132459858 CACACGGTGGTCCGGCATGGTGG - Intergenic
1108498762 13:51049768-51049790 CTCTCCTAGGATCTGCATGGTGG - Intergenic
1115811320 14:37111474-37111496 CTCTCAGTGGTTCTACATTCTGG + Intronic
1117199319 14:53372212-53372234 CTCTGGGTGGTTCAGCATTCAGG + Intergenic
1117555656 14:56880516-56880538 CTCTCGGGGCTTATGGATGGAGG - Intergenic
1121110155 14:91307185-91307207 CTCTCCCTGGTTCTGCCTGAGGG + Exonic
1123475730 15:20591806-20591828 CTCTGGGGGGGTCTTCATGGGGG + Intergenic
1123781049 15:23628824-23628846 CTCTGGGTGGTTGTGGGTGGGGG + Intronic
1126681756 15:51208959-51208981 CTCTGGCTGGAGCTGCATGGTGG - Exonic
1128056773 15:64705484-64705506 CTTTCTCTGGATCTGCATGGTGG + Intergenic
1129526992 15:76224687-76224709 CTCGCTGTGGTTCTACATGAGGG + Intronic
1131083566 15:89556538-89556560 CTCATAGTGGTTCTGCAAGGCGG - Intergenic
1131989755 15:98081708-98081730 CTCTCAGTGAGTCTGCTTGGAGG - Intergenic
1132508943 16:327199-327221 CTCGTGGGTGTTCTGCATGGCGG + Intronic
1138643807 16:58407859-58407881 CACTCAGTGCTTCTGCATGCCGG - Intergenic
1143378930 17:6483694-6483716 CTCCTGCTGGTCCTGCATGGGGG - Exonic
1148197323 17:45723502-45723524 TTCTCGCTGGCTTTGCATGGTGG + Intergenic
1149268834 17:54955172-54955194 CTCTGGATGGCTTTGCATGGTGG - Intronic
1153487037 18:5609474-5609496 CCCTCCGTGGTTTTGCATGCAGG - Intronic
1153675435 18:7452517-7452539 CTCTCTGCACTTCTGCATGGGGG - Intergenic
1159222161 18:65479319-65479341 CTCTCTGTGTCTTTGCATGGAGG + Intergenic
1160809930 19:1008949-1008971 GTCTGGGTGGTCCTGCATCGTGG - Intronic
1161001328 19:1912607-1912629 CTCCATGTGGCTCTGCATGGCGG - Exonic
1162479792 19:10921546-10921568 CTCTCTGTGACTCTGCCTGGGGG + Intronic
1165293717 19:34909088-34909110 TTCTCGATGGTTCTGAAAGGGGG - Intergenic
934987011 2:98894816-98894838 CTGTTGGTGGCTGTGCATGGTGG + Intronic
935028671 2:99301774-99301796 CTCTCGGTGGTTCAGAACAGGGG - Intronic
935029315 2:99306734-99306756 CTCTCGGTGGTTCAGAACAGGGG + Intronic
935212934 2:100954003-100954025 CTCTGTGTGGCCCTGCATGGTGG - Intronic
938125028 2:128665142-128665164 CTCCCAGTGGTTCCGCCTGGAGG - Intergenic
938868845 2:135452975-135452997 CTAACAGAGGTTCTGCATGGGGG + Intronic
940912869 2:159224534-159224556 CTCACGGTGTTTCTGCGGGGAGG + Intronic
942239598 2:173948110-173948132 CTCTGGGTTTTTCTGCATGTAGG + Intronic
1172953483 20:38738157-38738179 CTCTCCTTGGTTGGGCATGGTGG - Intergenic
1173661351 20:44736251-44736273 CTATGGGTGCTTCTGCTTGGTGG + Intergenic
1173912514 20:46680888-46680910 CTCACAGTGGTGCTGCATGGTGG - Intronic
1174576192 20:51539364-51539386 CTCTCTTTGCTTCTGTATGGTGG - Intronic
1175043339 20:56077245-56077267 ATCTAGGTGCTTCTGCTTGGTGG + Intergenic
1178612378 21:34095613-34095635 CTCTCGGTGGATCTGTATTCGGG + Exonic
1179638554 21:42731618-42731640 CTCACGGCGGGTCTGCACGGGGG - Intronic
1181855723 22:25780206-25780228 CTCTCGGGGGATGTGCAAGGGGG + Intronic
954224241 3:49172259-49172281 CTCACGCTGGTCCTGCATGAGGG - Intronic
956930711 3:74039968-74039990 CTCTGTGTGGTTCTGTGTGGTGG - Intergenic
962921736 3:139956404-139956426 CTCTCAGTGGCCCAGCATGGTGG + Intronic
966314799 3:178633311-178633333 CTCACGGAGGTTCTCCATGAGGG + Intronic
970499615 4:16664233-16664255 CTCTCTGTGTCTCTACATGGTGG - Intronic
974608443 4:64183849-64183871 CTAGCAGTGGTTCTGCATGAGGG + Intergenic
983559712 4:169088431-169088453 CTCTCAGGGGTTCTGCATCTTGG + Intergenic
988124089 5:27006449-27006471 CTCTTAGTGGTGCTGCATAGAGG - Intronic
988653756 5:33183921-33183943 CTCTCTGTGGTTCTGCATTTAGG + Intergenic
989656759 5:43753336-43753358 CTGGCAGAGGTTCTGCATGGGGG + Intergenic
993610683 5:90050442-90050464 CTCTCAGTGCATTTGCATGGGGG - Intergenic
993902709 5:93595423-93595445 CTGTCGGTGGGTGTGCTTGGGGG + Intergenic
996390759 5:122958541-122958563 CTCTTGGTGGTCAGGCATGGTGG - Intronic
1000136423 5:158356789-158356811 GACTCTGTGGTTCTGCAGGGTGG - Intergenic
1002770610 6:287653-287675 CTCTCTGTGGTTCTGCCTCTTGG - Intergenic
1005160160 6:22850443-22850465 CTCTAGGAGGTTCTGCAGGGAGG - Intergenic
1007244465 6:40450516-40450538 CCCTGGGTGGGTGTGCATGGGGG + Intronic
1007725957 6:43915714-43915736 TTCTCTGTGGCTCTGCAGGGTGG + Intergenic
1009823720 6:68839676-68839698 CATTTGGTGGTTCTGCAAGGAGG - Intronic
1012392111 6:98753713-98753735 CTCTCTCTGTTTCTGCGTGGTGG - Intergenic
1015732305 6:136361245-136361267 CCGTCGGTGGTTCTGTAGGGCGG + Intronic
1019825635 7:3281952-3281974 CACTGGGTGGTTCTGTCTGGGGG + Intergenic
1019956996 7:4423566-4423588 CACTCTGTGGTTGTGCATGCTGG + Intergenic
1022411153 7:30139659-30139681 CTGTGGGCTGTTCTGCATGGTGG - Intronic
1027304378 7:76877081-76877103 CTCGTGGTGGTGCTGCTTGGTGG - Intergenic
1030567974 7:111184735-111184757 CTATGGGTAGTTCTGAATGGTGG - Intronic
1033655171 7:143368407-143368429 TTCTCATTGGTTCTCCATGGAGG - Intergenic
1037814566 8:22105114-22105136 CTCCAGGTGGTTGTGCATGGTGG + Intergenic
1039923873 8:41911724-41911746 TCCTCGGTGGTTCTGCCAGGAGG - Intergenic
1044854239 8:96458156-96458178 CTCTCGATGGGTCTGCGTGGCGG - Intergenic
1046712991 8:117534145-117534167 CTGTCTGTGGTTCTCCATGGTGG + Intronic
1053166449 9:35847021-35847043 CACTGGGTGCTTGTGCATGGTGG + Intronic
1054751855 9:68915538-68915560 CTTTGGCTGGTTCTCCATGGAGG - Intronic
1058262898 9:102858695-102858717 TTCTTGGTTGTTTTGCATGGAGG + Intergenic
1059503372 9:114775967-114775989 TTCTCTGTGGTTCTGAATTGGGG + Intergenic
1059750494 9:117242863-117242885 CTCTGTGTGGTTCTGCAGGAAGG + Intronic
1061894236 9:133638854-133638876 CTCTCAGTGGGTCTCCCTGGTGG + Intronic
1187254004 X:17624761-17624783 CTCTCTGTTGTTCTGCCTGAGGG - Intronic
1187487308 X:19716738-19716760 CTCTAGGAGGTTCAGCATGCTGG + Intronic
1187649012 X:21379652-21379674 TTCTCAGTGCTTTTGCATGGAGG + Intronic
1188209634 X:27406778-27406800 CTCTCAGAGGTTCTGCAGTGAGG - Intergenic
1191781499 X:64872749-64872771 TTCTCAGAGCTTCTGCATGGGGG + Intergenic
1193320416 X:80114991-80115013 CTCTCAGAGGTTCTCCATGAGGG - Intergenic
1193636940 X:83962797-83962819 CTCTCTGGGGTTCTGCAGTGGGG - Intergenic