ID: 1081620866

View in Genome Browser
Species Human (GRCh38)
Location 11:44618569-44618591
Sequence TCTCGGTGGTTCTGCATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620861_1081620866 -3 Left 1081620861 11:44618549-44618571 CCGGGCTGGGACTGGGGGGCTCT 0: 1
1: 0
2: 2
3: 44
4: 393
Right 1081620866 11:44618569-44618591 TCTCGGTGGTTCTGCATGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1081620852_1081620866 13 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620866 11:44618569-44618591 TCTCGGTGGTTCTGCATGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1081620853_1081620866 12 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620866 11:44618569-44618591 TCTCGGTGGTTCTGCATGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620866 Original CRISPR TCTCGGTGGTTCTGCATGGC GGG Intronic
900215693 1:1480366-1480388 TCTGGGAGGTTCTGCTTGGGAGG + Intronic
902498226 1:16889579-16889601 GCTCGGTGGTCCTGCCGGGCGGG + Intronic
904272878 1:29362061-29362083 TCTCAGTGGCTCTGTATGGATGG - Intergenic
907287736 1:53392817-53392839 TCTCAGGGGATCTGCGTGGCAGG - Intergenic
907785472 1:57607916-57607938 CCTCTGTGGTTCTGCCTGGCTGG - Intronic
915086922 1:153395280-153395302 TGTCTGTGGTTCTGCCAGGCTGG + Intergenic
916850110 1:168695031-168695053 TCCCTGTGGTTTTGCCTGGCTGG + Intergenic
920416331 1:205801253-205801275 TCTCCCTGGTTCTGGGTGGCAGG - Intronic
922036143 1:221850581-221850603 GCTCGGTTGTTCTGCACGACTGG + Intergenic
922631969 1:227124626-227124648 ACTGGGTGATTCAGCATGGCTGG + Intronic
923207240 1:231771037-231771059 TTCCGGTGGCTCTGCATGGAAGG - Exonic
1062969917 10:1639432-1639454 TCTGGGTGTTTCTCCCTGGCTGG + Intronic
1070298172 10:75183072-75183094 TCTTGGTGGTTCTGTATTTCTGG - Intergenic
1076163190 10:128261887-128261909 TCTCAGTGGCTGTGCATGGCTGG + Intergenic
1077173435 11:1178427-1178449 TCCCGGTGCCTCTGCAGGGCAGG + Intronic
1077186318 11:1236908-1236930 TCTCGCTGCCTCTGCAGGGCAGG + Exonic
1077674981 11:4187520-4187542 TCTCGTTAGCTCTGCTTGGCCGG + Intergenic
1078456663 11:11481119-11481141 TCTGGGTGGCTGTGCATAGCTGG + Intronic
1080770856 11:35340080-35340102 TGTCAGTGTGTCTGCATGGCTGG - Intronic
1081620866 11:44618569-44618591 TCTCGGTGGTTCTGCATGGCGGG + Intronic
1085236983 11:75022897-75022919 TCACTATGGTTCTGCAAGGCTGG + Intergenic
1085340797 11:75730231-75730253 TTTCTCTGGTTCTGCCTGGCTGG - Intronic
1088607001 11:111541611-111541633 TTTCAGTTGTTCTGCATGTCGGG + Intronic
1089126697 11:116181253-116181275 TCTCCTTGGAACTGCATGGCAGG - Intergenic
1090076213 11:123581478-123581500 TCCCCGTGGTTCTGCATTCCCGG - Intronic
1091841710 12:3626209-3626231 TCTCTGTAGTTTTGCATGTCTGG - Intronic
1093752139 12:22812106-22812128 TCTTGGTGGTGCAGCAGGGCTGG + Intergenic
1099453005 12:82830345-82830367 TCTCGGTGTCTCTGCAATGCAGG + Intronic
1104787290 12:131457834-131457856 TCTCCATGGTTCTGCCAGGCTGG - Intergenic
1107483744 13:40806880-40806902 TCTTGGTGCTTCTGCATAACAGG + Intronic
1112279965 13:98054465-98054487 TCCGGGTGGCTCTGCATGGCAGG - Intergenic
1113518591 13:110921826-110921848 CCCTGGTGCTTCTGCATGGCTGG - Intergenic
1113528442 13:111000977-111000999 TCCCAGTGGTTCTACAGGGCAGG - Intergenic
1115324460 14:32123692-32123714 GCTCGGTGCTTCTCCTTGGCTGG + Intronic
1121232455 14:92367669-92367691 TCGGGGTGGCTCAGCATGGCTGG + Intronic
1125261425 15:37830279-37830301 TCTCTGTGGTACTTCATAGCAGG + Intergenic
1125512882 15:40302344-40302366 TCTCTGTGGTCCTGCAGGCCTGG - Exonic
1125519219 15:40338966-40338988 TCTCGGTGGTTCCCCAGGCCTGG + Intronic
1125926157 15:43564869-43564891 TCTCGGTGCTTCAGACTGGCAGG + Exonic
1125939301 15:43664420-43664442 TCTCGGTGCTTCAGACTGGCAGG + Intronic
1128897986 15:71393232-71393254 TCTCGGTGGTTGTGCATATTTGG + Intronic
1129897091 15:79116496-79116518 TCTCCCTGGTTATGCATTGCTGG - Intergenic
1131083565 15:89556537-89556559 TCATAGTGGTTCTGCAAGGCGGG - Intergenic
1140586337 16:76296987-76297009 TCTGGGTTTTTCTTCATGGCTGG - Intronic
1141406219 16:83795624-83795646 TCTCTGTGGACCTGCCTGGCTGG - Intronic
1142245115 16:88966787-88966809 TCTGGGTGGCTCTGCAAGCCAGG - Intronic
1146398865 17:32488168-32488190 GCTCGCTGCTTCTGCAGGGCTGG + Exonic
1147652936 17:42072434-42072456 CTTAGGTGGTTCTGCAGGGCTGG - Intergenic
1150979640 17:70126814-70126836 TCTCCATGGTTCTGGATGTCAGG - Intronic
1152374389 17:79911576-79911598 GCTCGGTGGGTCAGCCTGGCTGG - Intergenic
1152378786 17:79931561-79931583 TCTCTGTCTTTCTGCCTGGCTGG - Intergenic
1157824796 18:50803155-50803177 TTTCTGTGTTTCTACATGGCCGG + Intronic
1158615769 18:58985213-58985235 TCTCGGCAGATCTGCAAGGCTGG + Exonic
1160507805 18:79437081-79437103 TCTGGGTGGTTCAGGATGGCCGG + Intronic
1162381845 19:10335849-10335871 TCACGGTGGTGCTGCTTCGCTGG - Exonic
1165361855 19:35341690-35341712 CCTGGGTGCATCTGCATGGCGGG - Exonic
1165364308 19:35355397-35355419 TCTTGGGGGTTCTGCTTGGAAGG - Intergenic
1166301997 19:41916133-41916155 TCTGTGTGGTTGTGCTTGGCAGG - Intronic
926952877 2:18262502-18262524 TCTCGGCAGATCTGCAAGGCTGG + Intronic
927496459 2:23554826-23554848 TCCAGGTGGGTCTGCGTGGCAGG + Intronic
927874934 2:26648896-26648918 CCTCGGGTGTTCTGCATGCCTGG - Intergenic
929096404 2:38267079-38267101 TCTGGCAGGGTCTGCATGGCTGG + Intergenic
934151701 2:89153527-89153549 CCTCACTGATTCTGCATGGCTGG + Intergenic
934215558 2:90028379-90028401 CCTCACTGATTCTGCATGGCTGG - Intergenic
934752381 2:96801252-96801274 CCTCAGTGGCTCTGCTTGGCTGG + Intronic
938138051 2:128775185-128775207 CCTCGCTGGTCCTGCAAGGCTGG + Intergenic
941476047 2:165953443-165953465 GCTCGGTGTTTCTGAATTGCTGG - Intronic
943058657 2:183014742-183014764 TCTCATTGTTTCTTCATGGCAGG - Intronic
944594165 2:201246187-201246209 TGTTGGTGGTTCTGGATTGCAGG + Intronic
944686655 2:202123556-202123578 TCTCGGTGCTCCTGCATCTCAGG - Intronic
948621168 2:239235599-239235621 TCTCGGAGAGGCTGCATGGCTGG + Intronic
1169698134 20:8415017-8415039 TCTCAGTGTTTCTGAATGGGTGG - Intronic
1171946442 20:31382583-31382605 TCTACGTGGTTCTGGCTGGCAGG - Intronic
1172950065 20:38717466-38717488 TCTAGGTGAGTCTGCAGGGCAGG - Intergenic
1176024720 20:62979970-62979992 CCTGGGTGGGTCTGCACGGCAGG - Intergenic
1177253572 21:18629502-18629524 TTTTGGTGGTTCTGCATCCCTGG + Intergenic
1185310265 22:50150411-50150433 TCTGGAAGCTTCTGCATGGCTGG - Intronic
950449168 3:13055941-13055963 TCTCGGTGGTGCTACTTGGCAGG - Intronic
953131573 3:40144395-40144417 TCTATGTGGTTCTGGAAGGCTGG - Intronic
953578629 3:44133726-44133748 TCTAGGTGGTGCTGCTGGGCTGG - Intergenic
962248953 3:133823137-133823159 TCCCGTTGGGGCTGCATGGCTGG - Intronic
967125982 3:186425108-186425130 CCTCTGTGGTTCTGCTTGGCTGG + Intergenic
967317970 3:188167544-188167566 TTTCAGTGGCACTGCATGGCAGG - Intronic
972325510 4:38011629-38011651 TCTTGGTGCTTCTGAATGACGGG + Intronic
975835913 4:78422038-78422060 TCTCTGTGGCTCTACATGACAGG + Intronic
979920840 4:126493899-126493921 TCTCTGTGATTCTCTATGGCAGG - Intergenic
988653757 5:33183922-33183944 TCTCTGTGGTTCTGCATTTAGGG + Intergenic
990448180 5:55912426-55912448 TCTCCATGGTTTTGCATGGCTGG + Intronic
998387801 5:141767976-141767998 TCTCGGTGGGGCTGCTTGGATGG + Intergenic
999105477 5:149067279-149067301 CCCTGGTTGTTCTGCATGGCTGG - Intergenic
1000136422 5:158356788-158356810 ACTCTGTGGTTCTGCAGGGTGGG - Intergenic
1005451056 6:25972823-25972845 TCTGGGAGATTCAGCATGGCAGG - Intronic
1007725958 6:43915715-43915737 TCTCTGTGGCTCTGCAGGGTGGG + Intergenic
1020068980 7:5213006-5213028 TCTGAGTGGTGCTGCATGCCAGG + Intronic
1022386149 7:29901023-29901045 TCTGGGTGGTTATGAATGGGAGG + Intronic
1024005337 7:45221444-45221466 TCTCGGTGATTTTCCATGGCAGG - Intergenic
1030123567 7:106133978-106134000 TCTCAGTTGTGCTTCATGGCAGG - Intergenic
1032250960 7:130256810-130256832 TCCCAAGGGTTCTGCATGGCAGG + Intergenic
1032741920 7:134748050-134748072 TCCCAGTGGGTCTGCAAGGCAGG + Intronic
1034940191 7:155225652-155225674 CCTCTGTGCTTCTGGATGGCAGG - Intergenic
1035106369 7:156444946-156444968 CCTCGGTGGCTGAGCATGGCGGG - Intergenic
1044854238 8:96458155-96458177 TCTCGATGGGTCTGCGTGGCGGG - Intergenic
1047787556 8:128168488-128168510 TTTCTGTGGTTCTCCAGGGCTGG + Intergenic
1048682908 8:136866001-136866023 TCTCGGCAGATCTGCAAGGCTGG + Intergenic
1049469287 8:142768284-142768306 TCTGGGTGTAGCTGCATGGCTGG + Intronic
1050340871 9:4637260-4637282 TCTCTGGGTCTCTGCATGGCTGG + Intronic
1052460629 9:28758030-28758052 TCTCCATGGTTCTCCATGGAAGG + Intergenic
1055257950 9:74394617-74394639 TCTCTGTGCTTCTTCAGGGCAGG + Intergenic
1062706731 9:137949606-137949628 CATCTGTGGTTCTGCCTGGCGGG + Intronic
1185864060 X:3606884-3606906 TCTCATTTGTTCTGTATGGCTGG + Exonic
1186017938 X:5219488-5219510 GCTGGGTGGTTCTGCATGTTAGG + Intergenic
1187114045 X:16331273-16331295 TCTGTATGGTTCTGCATGCCAGG + Intergenic
1187649013 X:21379653-21379675 TCTCAGTGCTTTTGCATGGAGGG + Intronic
1189217385 X:39337782-39337804 TCCCAGTGGTTCTGAATGGCAGG - Intergenic
1189318436 X:40072794-40072816 TCACGGTGCTGCTGCAGGGCCGG + Exonic
1192907793 X:75569833-75569855 TCTCCCTGGTTCTGGATGTCTGG - Intergenic
1194812956 X:98408067-98408089 TCTCAGTGGTTCTGCCTTGTAGG - Intergenic
1198804644 X:140481650-140481672 GCTTGGTGTTTCTGCATGTCGGG + Intergenic
1198955667 X:142126624-142126646 TCTTGGTGCTTCTGCATAACAGG + Intergenic
1200698211 Y:6379839-6379861 TCTATGTGGCTCTGCATGGATGG - Intergenic
1200800122 Y:7379131-7379153 TCTCATTTGTTCTGTATGGCTGG - Intergenic
1201035902 Y:9784860-9784882 TCTATGTGGCTCTGCATGGATGG + Intergenic