ID: 1081620867

View in Genome Browser
Species Human (GRCh38)
Location 11:44618570-44618592
Sequence CTCGGTGGTTCTGCATGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620861_1081620867 -2 Left 1081620861 11:44618549-44618571 CCGGGCTGGGACTGGGGGGCTCT 0: 1
1: 0
2: 2
3: 44
4: 393
Right 1081620867 11:44618570-44618592 CTCGGTGGTTCTGCATGGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 93
1081620853_1081620867 13 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620867 11:44618570-44618592 CTCGGTGGTTCTGCATGGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 93
1081620852_1081620867 14 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620867 11:44618570-44618592 CTCGGTGGTTCTGCATGGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620867 Original CRISPR CTCGGTGGTTCTGCATGGCG GGG Intronic
901076215 1:6556249-6556271 CTCCATGGTTCTTCATGGGGTGG + Intronic
901404625 1:9038081-9038103 CCTGGTGGGTCTGCATGGCCAGG - Intronic
903770057 1:25758167-25758189 ATTGGTGGTTCTGCATGTGGAGG - Intronic
909849153 1:80438310-80438332 ATTGATGGTTCTGCATGGCTAGG + Intergenic
912269432 1:108193895-108193917 CTCTGTGGTTCTGGAGGGTGAGG - Intronic
918419571 1:184350779-184350801 ATCGGTAGGTCTGCAGGGCGTGG - Intergenic
921713436 1:218395443-218395465 GTTGGTGTTTCTGCCTGGCGTGG + Intronic
1064670939 10:17713294-17713316 CCCGGTGATTCTGAATGCCGTGG + Intronic
1067455086 10:46413384-46413406 CTCAGTCCTTCTGCAGGGCGGGG + Intergenic
1068137629 10:52965892-52965914 CTGGGTGGTTGTGGCTGGCGTGG + Intergenic
1076163191 10:128261888-128261910 CTCAGTGGCTGTGCATGGCTGGG + Intergenic
1076965037 11:75958-75980 ATTGGTGGTTCTGGCTGGCGTGG + Intergenic
1077602132 11:3581224-3581246 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
1080946269 11:36978716-36978738 CCCTGTGGTTCTGCAGGGCTTGG + Intergenic
1081620867 11:44618570-44618592 CTCGGTGGTTCTGCATGGCGGGG + Intronic
1083731070 11:64653053-64653075 CAGGGTGTTTCTGCATGGTGTGG - Intronic
1084258035 11:67955779-67955801 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
1084575891 11:69987695-69987717 CTGGGTGATTCTGCCTGGGGTGG - Intergenic
1088607002 11:111541612-111541634 TTCAGTTGTTCTGCATGTCGGGG + Intronic
1092428278 12:8390576-8390598 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
1092429354 12:8396729-8396751 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
1096485103 12:51974925-51974947 CTAGGTGGCTCTGCATGAAGTGG + Intronic
1098302815 12:69071095-69071117 CTGTGTGGCTCTGCATGGCATGG + Intergenic
1102990394 12:117311537-117311559 CTCGGTCGTTCTCCACGCCGAGG + Exonic
1103269115 12:119657489-119657511 TCCTGTGGTTCTGCATGGCATGG + Intergenic
1110705225 13:78596652-78596674 TCCGGTGGATCTGCAGGGCGGGG - Intergenic
1113518589 13:110921825-110921847 CCTGGTGCTTCTGCATGGCTGGG - Intergenic
1115314955 14:32015718-32015740 CTGGCTGCTTCTGGATGGCGAGG - Intronic
1116919837 14:50560749-50560771 CTCGCTGGCTCTGCAGGGCGCGG + Intronic
1123997342 15:25728060-25728082 CTTGGTGGCCCTGCCTGGCGTGG - Intronic
1131055404 15:89371753-89371775 CCCGGCGGTTCTGCACCGCGCGG - Intergenic
1132461306 16:56469-56491 CTGAGTGGCTCTGCATGACGTGG - Intronic
1133369950 16:5239777-5239799 CTCGGTGGGTCCGCGCGGCGCGG - Intergenic
1133985054 16:10662102-10662124 CTGGGTGATTCTCCATGGTGGGG + Intronic
1137450375 16:48568151-48568173 CCCTGTGGTCCTGCATGGCATGG + Intronic
1138316160 16:56072270-56072292 CTCTGTGGCTGTGCTTGGCGGGG - Intergenic
1139441314 16:66969046-66969068 CTGGGTAGATCTGCCTGGCGTGG + Intronic
1139718182 16:68831026-68831048 CTCGGTGAGTCTTCATGGTGAGG + Intronic
1142001896 16:87668986-87669008 CTCGGAGGTCCTGCGAGGCGAGG + Intronic
1142012398 16:87722484-87722506 GACCGTGGTTCTGCATGGCAAGG - Intronic
1142413092 16:89926062-89926084 CCCGGTGTTTCTGCATAGCCCGG - Intronic
1143608464 17:8003871-8003893 CTCGGTGCTGCTGGGTGGCGAGG + Exonic
1143908256 17:10226948-10226970 CTCAGTCGCTCTGCAGGGCGAGG - Intergenic
1147652935 17:42072433-42072455 TTAGGTGGTTCTGCAGGGCTGGG - Intergenic
1153928383 18:9855863-9855885 CTCATGGGTTTTGCATGGCGGGG - Intronic
1160641842 19:145588-145610 ATTGGTGGTTCTGGCTGGCGTGG + Intergenic
1161345843 19:3768424-3768446 CTTGGGGGTTCTGCAGGACGTGG - Intronic
1161490519 19:4558442-4558464 CTCGCGGGGTCTGCATGGCGAGG + Exonic
1165059319 19:33197233-33197255 CCAGGTGGCCCTGCATGGCGTGG - Intronic
925297264 2:2785753-2785775 CTCGGTGGTCCTGTCTGGGGTGG + Intergenic
927874933 2:26648895-26648917 CTCGGGTGTTCTGCATGCCTGGG - Intergenic
927967830 2:27282706-27282728 CTCGGTGGTCGTGCCTGGCCTGG - Exonic
929996522 2:46829470-46829492 CTTGGTGGTGCTTCCTGGCGGGG + Intronic
933945499 2:87282992-87283014 GTCTGTGGTTCTGCCTGGGGCGG - Intergenic
934151702 2:89153528-89153550 CTCACTGATTCTGCATGGCTGGG + Intergenic
934215557 2:90028378-90028400 CTCACTGATTCTGCATGGCTGGG - Intergenic
934752382 2:96801253-96801275 CTCAGTGGCTCTGCTTGGCTGGG + Intronic
936334711 2:111578597-111578619 GTCTGTGGTTCTGCCTGGGGCGG + Intergenic
946490475 2:220144582-220144604 CTTGGTGGTTCCTGATGGCGTGG + Intergenic
1169149949 20:3281720-3281742 CTGGGTGGGTCTGCAGGGCCTGG + Exonic
1173853250 20:46232266-46232288 GTGGGTGGTGCTGCATGGAGTGG + Intronic
1179893751 21:44350435-44350457 CCCGGTGCTGCTGCAGGGCGCGG + Intronic
1184648194 22:45907406-45907428 CTGTGTGGTCCTGCGTGGCGTGG + Intergenic
1185307256 22:50126656-50126678 CCAGATGGTTCTGCATGGGGTGG + Intronic
956601277 3:71025314-71025336 TTCGGTGGTTCTGGGTGGTGGGG + Intronic
957072976 3:75580288-75580310 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
961281107 3:125766490-125766512 CTCGGTGGGTCCGCGCGGCGCGG - Intergenic
961351748 3:126308552-126308574 CTCGGGGGTTCTGCCTGCCCTGG + Intergenic
961873277 3:130003095-130003117 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
969737375 4:9000731-9000753 CTCGGTGGGTCCGCGTGGCGCGG - Intergenic
969849892 4:9947910-9947932 CTGCGTGGTCCTGCATGGCGTGG + Intronic
972238171 4:37158325-37158347 CTGTGTGGCTCTGCATGGTGTGG - Intergenic
972325511 4:38011630-38011652 CTTGGTGCTTCTGAATGACGGGG + Intronic
975297325 4:72749585-72749607 CCCTGTGGCTCTGCATGGCATGG + Intergenic
985826640 5:2196673-2196695 CTCGGTGGGTCTCCTTGACGTGG + Intergenic
985927109 5:3027171-3027193 CTTGTTGGTCTTGCATGGCGGGG + Intergenic
990494638 5:56335176-56335198 CTCTGTGGCTCTGCAGGGCTTGG + Intergenic
1000136421 5:158356787-158356809 CTCTGTGGTTCTGCAGGGTGGGG - Intergenic
1017748868 6:157471430-157471452 CTCGGGGGTTCTGGATGGGGAGG - Intronic
1019083986 6:169457010-169457032 CTCGTGGGTTCTGCATGGTGAGG - Intergenic
1020837165 7:13168118-13168140 CTCTGTGGTTCTGCAGGGTACGG + Intergenic
1022189113 7:27999761-27999783 CTCTGTGGTACTGCATGTCCAGG - Intronic
1024005336 7:45221443-45221465 CTCGGTGATTTTCCATGGCAGGG - Intergenic
1029109741 7:98206901-98206923 TTGGGTGGTCCTGCATGGCCCGG + Exonic
1031586032 7:123533173-123533195 CTAGAGGGGTCTGCATGGCGGGG - Intronic
1032803326 7:135333926-135333948 CTGTGTGGCTCTGCATGGCATGG - Intergenic
1034940190 7:155225651-155225673 CTCTGTGCTTCTGGATGGCAGGG - Intergenic
1036258318 8:7222018-7222040 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
1036259379 8:7228162-7228184 CTCGGTGGGTCCGCGTGGCGCGG + Intergenic
1036307247 8:7611362-7611384 CTCGGTGGGTCCGCGCGGCGCGG - Intergenic
1036310372 8:7680614-7680636 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
1036311421 8:7686732-7686754 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
1036358089 8:8059349-8059371 CTCGGTGGGTCCGCGCGGCGCGG - Intergenic
1036359166 8:8065489-8065511 CTCGGTGGGTCCGCCGGGCGCGG - Intergenic
1036830260 8:12015137-12015159 CTCGGTGGGTCAGCGCGGCGCGG + Intronic
1036891791 8:12601463-12601485 CTCGGTGGGTCCGCCCGGCGAGG + Intergenic
1036892858 8:12607597-12607619 CTCGGTGGGTCCGCGCGGCGCGG + Intergenic
1044242527 8:89902960-89902982 CTCGGCCGTCCTGCCTGGCGTGG + Intronic
1044854237 8:96458154-96458176 CTCGATGGGTCTGCGTGGCGGGG - Intergenic
1056720487 9:89067023-89067045 CCCGGTCATTCTGCAGGGCGTGG + Intronic
1062076248 9:134591497-134591519 CCGGGTGGCCCTGCATGGCGTGG + Intergenic
1062759485 9:138331504-138331526 ATTGGTGGTTCTGGCTGGCGTGG - Intergenic
1190267394 X:48835524-48835546 CTCGCTGGGGCAGCATGGCGGGG - Exonic
1198804645 X:140481651-140481673 CTTGGTGTTTCTGCATGTCGGGG + Intergenic