ID: 1081620868

View in Genome Browser
Species Human (GRCh38)
Location 11:44618573-44618595
Sequence GGTGGTTCTGCATGGCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620853_1081620868 16 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620868 11:44618573-44618595 GGTGGTTCTGCATGGCGGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 188
1081620861_1081620868 1 Left 1081620861 11:44618549-44618571 CCGGGCTGGGACTGGGGGGCTCT 0: 1
1: 0
2: 2
3: 44
4: 393
Right 1081620868 11:44618573-44618595 GGTGGTTCTGCATGGCGGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 188
1081620852_1081620868 17 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620868 11:44618573-44618595 GGTGGTTCTGCATGGCGGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620868 Original CRISPR GGTGGTTCTGCATGGCGGGG TGG Intronic
900956543 1:5889627-5889649 GCAGGCTCTGCATGGTGGGGAGG - Intronic
901260296 1:7866041-7866063 TGTGGCTCTTCATGGAGGGGCGG - Intergenic
901471065 1:9456787-9456809 TGTGGTTCAGCGTGGGGGGGGGG + Intergenic
901796280 1:11681236-11681258 GGCGGTTCCGCATGCGGGGGCGG + Exonic
903154927 1:21436773-21436795 GGTGCTTGTGCAAGGCGGAGTGG - Intergenic
905237790 1:36561927-36561949 GGTGGCTCTACGTGGTGGGGAGG + Intergenic
912763128 1:112386395-112386417 GGTGGTTGGGCATGCAGGGGTGG + Intergenic
914804285 1:150981447-150981469 GCAGTTGCTGCATGGCGGGGCGG + Intergenic
921278203 1:213540080-213540102 GGTGGTTCTGAAGGTTGGGGTGG + Intergenic
921337951 1:214107348-214107370 GGTGGGACTGGCTGGCGGGGAGG + Intergenic
923926133 1:238629419-238629441 GATGGTTCTGCATGGTAGGCAGG - Intergenic
1063662605 10:8044496-8044518 GGTGGTTTTGCAGGGAGGGCTGG + Intergenic
1064008311 10:11715226-11715248 GGCAGTTCTGCCTGGCAGGGAGG - Intergenic
1064344794 10:14522370-14522392 GGGGGCTCTGCATGGAGGGGAGG + Intronic
1070775394 10:79106795-79106817 GGTGGTTCGGCCTGGCTTGGCGG + Intronic
1074094989 10:110304374-110304396 TGAGGTGCTGCGTGGCGGGGAGG - Intronic
1076433737 10:130425477-130425499 GGTATTGCTGCATGGCTGGGTGG + Intergenic
1076764849 10:132627406-132627428 GGTGGGTCTGGAGGGCGGTGGGG + Intronic
1076988811 11:258262-258284 GGTGGTCCTGCAGGCCGAGGTGG - Intergenic
1077297105 11:1831493-1831515 GCAGGTTCTGCACGACGGGGAGG - Intronic
1078101700 11:8333988-8334010 GGTGGGCCTGCATGGCAGGATGG + Intergenic
1080306368 11:30840675-30840697 GGTGGTTCTGCATAAGGGGAAGG + Intronic
1080941039 11:36918405-36918427 GGTGGGTTGGCATGGCGGGCAGG + Intergenic
1081620868 11:44618573-44618595 GGTGGTTCTGCATGGCGGGGTGG + Intronic
1082742724 11:56928687-56928709 AGTAGTTCTGCATGGTGGGTAGG - Intergenic
1083185253 11:61013920-61013942 GGTGGTTCACCATTACGGGGAGG - Exonic
1085008305 11:73115247-73115269 GGAGATTCTGCATGTCAGGGAGG - Intronic
1085200935 11:74701800-74701822 GATGGTTTTGGCTGGCGGGGTGG - Intronic
1085410360 11:76287243-76287265 GATGGCTCTGCAGGGAGGGGTGG - Intergenic
1088919391 11:114250456-114250478 TGTGCTTCTGCATGGAGGAGAGG - Exonic
1090485405 11:127108189-127108211 GGTGGTGATGGTTGGCGGGGAGG - Intergenic
1091232790 11:133999429-133999451 CGCGGCTCTGCATGGTGGGGTGG - Intergenic
1091283477 11:134395419-134395441 GGTGCTTCTGCTTGGCCGAGTGG + Intronic
1092159521 12:6308480-6308502 GGTGGTGGTGGGTGGCGGGGTGG - Intergenic
1096485106 12:51974928-51974950 GGTGGCTCTGCATGAAGTGGGGG + Intronic
1096543363 12:52321081-52321103 GGTGGTGATGCATGGGGGGCTGG + Exonic
1097385642 12:58947372-58947394 GCTGGTTCTGCTGGGCGCGGTGG - Intergenic
1103269117 12:119657492-119657514 TGTGGTTCTGCATGGCATGGCGG + Intergenic
1103520672 12:121535757-121535779 GGTGTTTCTGCAAGGAAGGGTGG - Intronic
1103603924 12:122072650-122072672 GGTGGTTCTGATTGCCCGGGGGG - Intergenic
1103723487 12:122986765-122986787 GCTGCTTCTGCATGTCGGGCCGG + Exonic
1104387498 12:128363995-128364017 GGTGGTGCTTCATGGAGGAGGGG + Intronic
1106690020 13:32104920-32104942 CACGGTTCTGCATGGCTGGGAGG - Intronic
1107151103 13:37112650-37112672 GGTGGCTATGCATGGCTGGCAGG - Intergenic
1108256619 13:48617627-48617649 GGTGTTGCTGCAGGGCTGGGTGG - Intergenic
1110205443 13:72906800-72906822 GGTGGTTTTGCAGGGGGAGGTGG + Intronic
1110316474 13:74114185-74114207 GGTGGTTCTGAAGGTTGGGGTGG - Intronic
1111050794 13:82881539-82881561 CATGGTTCTGCAGGGCGGGCAGG - Intergenic
1111426218 13:88086741-88086763 TGTGGTTTTGCAAGGCAGGGAGG + Intergenic
1113902115 13:113803216-113803238 TGTGGCTCTGCATTGCGGGCTGG - Intronic
1114406988 14:22466083-22466105 AGAGATTCTGCATGGCGTGGAGG + Intergenic
1118985793 14:70753664-70753686 GGTGGGTCTGTGTTGCGGGGAGG - Intronic
1121608473 14:95259152-95259174 GTTGGTGCTGCATGGCAGGCTGG + Intronic
1121936759 14:98027079-98027101 GACAGTTCTGCATGGCTGGGAGG + Intergenic
1122633845 14:103121290-103121312 GGGGGCTCTGCCTGGTGGGGAGG - Intergenic
1124956986 15:34366478-34366500 GGAGGTGCTGCAGTGCGGGGTGG + Intronic
1125919778 15:43518510-43518532 GCTGCTTCTGCATGGGGGGTGGG - Intronic
1125964941 15:43866567-43866589 GTTGCTTCTGCAGGACGGGGAGG + Exonic
1128019912 15:64381289-64381311 TGTGGTACTGGAGGGCGGGGGGG - Intronic
1128258080 15:66212796-66212818 GGTGCTCCTGTATGGCTGGGGGG - Intronic
1128323072 15:66705984-66706006 GGTGGTTGGGCAGGGAGGGGAGG + Intronic
1129458660 15:75689066-75689088 GGTGGATCTGTATGGCCGGCCGG + Exonic
1129725133 15:77897806-77897828 GGTGGATCTGTATGGCCGGCTGG - Intergenic
1133314258 16:4872462-4872484 GGTGGGTGGGCATGGTGGGGGGG + Intronic
1135283710 16:21174764-21174786 GGTGGTTTTCTTTGGCGGGGTGG + Intronic
1137864129 16:51876116-51876138 GGAGGTTCTGTATGGCTTGGGGG + Intergenic
1138590699 16:57998183-57998205 GGTGGCTCTGCATGGTGCTGAGG + Exonic
1140151622 16:72373081-72373103 GGTGGTGCTGTATGGAGGGGAGG - Intergenic
1141689871 16:85590769-85590791 GGTGGTGCAGCGTGGCCGGGCGG - Intergenic
1141732034 16:85829383-85829405 GGTGGTTCTGCCTGGGGAAGTGG + Intergenic
1141982536 16:87559352-87559374 GGTGGGGCGGGATGGCGGGGAGG + Intergenic
1143517170 17:7425679-7425701 GCTGGTTTTCCATGGAGGGGGGG - Exonic
1143585311 17:7847819-7847841 GGTGGTGGGGCAGGGCGGGGGGG - Exonic
1144030734 17:11320330-11320352 GGTGTTTGTGCATGGGGGGTGGG + Intronic
1145041941 17:19583425-19583447 TGTGGTTAGGCATGGCGTGGTGG + Intergenic
1145315392 17:21728371-21728393 GGTGGTTCTGAAGGTTGGGGTGG + Intergenic
1145713822 17:27000308-27000330 GGTGGTTCTGAAGGTTGGGGTGG + Intergenic
1146341162 17:32020932-32020954 GGTGTTCCGGCCTGGCGGGGTGG + Intronic
1146729777 17:35183471-35183493 GGTGGTGCTGCTCTGCGGGGAGG + Exonic
1148557456 17:48587023-48587045 GGTGGTAATGGTTGGCGGGGTGG - Intronic
1149409772 17:56393365-56393387 GCTGGTTCTGTATGGGTGGGAGG - Intronic
1149596745 17:57868695-57868717 TGTGGGTCTGTGTGGCGGGGAGG + Intronic
1152564080 17:81092412-81092434 GGTGGGGCTGCAGGGAGGGGTGG + Intronic
1152892370 17:82889951-82889973 TGTGGCTCTGCAGGGTGGGGCGG + Intronic
1153747839 18:8198612-8198634 GCTGGTTCTGTATTGCGGAGAGG + Intronic
1153872063 18:9330780-9330802 GCTGGTTCTATATGGCGGGAGGG - Intergenic
1154387082 18:13903695-13903717 GGTGGTTCTGGAGGGAGGTGGGG + Intronic
1157504149 18:48214305-48214327 GGTGGTTGCCCATGGCTGGGAGG - Intronic
1160362734 18:78297446-78297468 GGTGGTTCTGTGTGGCCAGGTGG - Intergenic
1160970759 19:1766809-1766831 GGTGGTGGAGCATGGGGGGGGGG - Intronic
1161071524 19:2264202-2264224 GTTGGTTCAGCCTGGCGCGGTGG + Intronic
1162381843 19:10335845-10335867 GGTGGTGCTGCTTCGCTGGGAGG - Exonic
1162518851 19:11167021-11167043 GGTGGTTGTGCAGGGCCTGGTGG + Intronic
1162562598 19:11426260-11426282 GCTGGTTCTGGAGGGCGGGCAGG + Exonic
1162856103 19:13469744-13469766 GGTGGTTCAGCCGGGCGCGGTGG - Intronic
1164980880 19:32613597-32613619 TCTGTTTCTCCATGGCGGGGTGG - Intronic
1165112900 19:33512637-33512659 CGTGGTCCTGCAGGGCGGGGAGG - Exonic
1165361854 19:35341686-35341708 GGTGCATCTGCATGGCGGGCAGG - Exonic
1165395851 19:35563262-35563284 GGTCGTTCTGTGTGGTGGGGTGG + Exonic
1166926369 19:46271557-46271579 GACAGTTCTGCATGGCTGGGAGG + Intergenic
1167766951 19:51489952-51489974 GGTGGTTCTGCCAGGCCAGGGGG - Intronic
1168137402 19:54360637-54360659 GCTGGCTCTGCTTGGCTGGGTGG - Intronic
1168160675 19:54508445-54508467 GCTGGCTCTGCTTGGCTGGGTGG + Intronic
924964209 2:60230-60252 GGTGGTTCAGCACAGCAGGGAGG + Intergenic
926094597 2:10073061-10073083 GTGGGCTCTGCATGGGGGGGCGG + Intronic
927697188 2:25246567-25246589 TGTGGATCTGCCTGGCGGGCAGG + Intronic
931368934 2:61643943-61643965 GTTGGTTCTGGCTGGCGCGGTGG + Intergenic
936105914 2:109624181-109624203 GGTGGTGCTCCAGGGAGGGGTGG + Intergenic
938733463 2:134164497-134164519 GGTGGTTCTGCTTGTCTGTGGGG + Intronic
938868316 2:135447586-135447608 GGTGGTTCAGAATGAAGGGGTGG + Intronic
939365978 2:141231623-141231645 GGAGGTTGTGGGTGGCGGGGCGG - Intronic
946247506 2:218396133-218396155 CGTCGTTCCGCCTGGCGGGGAGG - Exonic
947392135 2:229650602-229650624 GGTGGTCGTTCATGGAGGGGTGG - Intronic
947612095 2:231530786-231530808 GGTGGGTCTGAATGGGGGGCAGG - Intergenic
947751058 2:232532569-232532591 GGTGCTTCTGCACGGCTGAGCGG - Intronic
948512305 2:238476719-238476741 GGTGGTGGTGAATGGCGGAGGGG + Intergenic
948935512 2:241161761-241161783 GGTGGATCTGCCAGGCAGGGAGG + Intronic
1168846540 20:948995-949017 CATAGTTCTGCATGGCTGGGGGG + Intergenic
1169489748 20:6061433-6061455 GGTAGTTCAGTATGGTGGGGGGG + Intergenic
1170704016 20:18728468-18728490 TGTGGTTCTGCAAGTCTGGGTGG + Intronic
1170836379 20:19888202-19888224 GATGGTTCTGGAAGGAGGGGTGG + Intronic
1170990616 20:21298708-21298730 GGTGGTTCTGCATGATGTGCAGG - Intergenic
1172160388 20:32863918-32863940 GGTGTTTCTGCATCGGGGAGGGG + Intronic
1172962340 20:38807479-38807501 GGTGGTTCTGCAGGGGCTGGGGG + Intronic
1173833092 20:46105230-46105252 GGTCATACTGCATGGGGGGGGGG + Intergenic
1175400638 20:58698172-58698194 AGTGCTTCTGCTTGGTGGGGAGG + Intronic
1175763595 20:61577995-61578017 GGCAGTCCTGCATGGTGGGGAGG - Intronic
1176009075 20:62882144-62882166 GGTGGTTCTGGAAGAGGGGGCGG + Exonic
1176024719 20:62979966-62979988 GGTGGGTCTGCACGGCAGGCAGG - Intergenic
1177015985 21:15787903-15787925 GGTGGTTTTACTTGGGGGGGGGG - Intronic
1178514011 21:33230598-33230620 GCCGGTTTTGCAAGGCGGGGTGG - Intronic
1179893753 21:44350438-44350460 GGTGCTGCTGCAGGGCGCGGCGG + Intronic
1182413817 22:30208342-30208364 GAAGTTTCTGGATGGCGGGGTGG - Intergenic
1183467418 22:37986692-37986714 GGTGGGCCTGCAGGGCGGGTGGG + Intronic
1184005529 22:41705455-41705477 GGTGGTTAGGCAGGGCGCGGTGG - Intronic
1184288047 22:43483102-43483124 GCTGGGCCTGCATGGCAGGGAGG + Intronic
1184517716 22:44972957-44972979 GGACCTCCTGCATGGCGGGGAGG - Intronic
1184601733 22:45547845-45547867 GGTGGTGGTGCATGGCTGAGAGG + Intronic
1184795176 22:46728021-46728043 GGAGGTTCTGGAGGGCAGGGTGG + Intronic
1184871019 22:47238580-47238602 GATGGGTCTGCATTGCAGGGAGG + Intergenic
950646181 3:14378180-14378202 GGTGTTTCTGCTTGGGGGTGTGG - Intergenic
950655093 3:14431605-14431627 GCTGGTTCTGGATGGTGGAGGGG + Intronic
956000584 3:64725877-64725899 GGTGGGTATGCATGGAGAGGAGG - Intergenic
956601278 3:71025317-71025339 GGTGGTTCTGGGTGGTGGGGTGG + Intronic
957284707 3:78203440-78203462 GGTGGTTCCCCATGCCTGGGGGG - Intergenic
961567691 3:127775502-127775524 CGTGGTTCTCCTTGGCGGGTGGG - Intronic
961721976 3:128903028-128903050 GGTGACTCTGCATGGTGGGTGGG + Intronic
963747107 3:149135551-149135573 CGCAGTTCTGCATGGCTGGGGGG - Intronic
966906948 3:184533152-184533174 GGAGGATCTGCATGGGGGTGAGG - Intronic
968597295 4:1492014-1492036 GCTGCTTCTGCCTGTCGGGGTGG - Intergenic
969229876 4:5822482-5822504 GGTGGATCTGAAGGGGGGGGGGG + Intronic
978556978 4:109991482-109991504 GGTGTTTAGGCATGGCGCGGAGG + Intronic
983631104 4:169850048-169850070 GAAGGCTCTGCATGGTGGGGAGG + Intergenic
984084229 4:175288382-175288404 GGTGGTTCTGAAGGTTGGGGTGG + Intergenic
984992809 4:185397058-185397080 GCTGGTTGTGAAGGGCGGGGAGG + Intronic
985927110 5:3027174-3027196 GTTGGTCTTGCATGGCGGGGAGG + Intergenic
987878669 5:23712344-23712366 GGTGGCTCTGCAGGGCTGGGCGG - Intergenic
988772938 5:34450217-34450239 GGTGGTGCAGCATGGCGGCCAGG - Intergenic
990953365 5:61320197-61320219 GGTGGTTGTCTATGGTGGGGTGG + Intergenic
991213646 5:64135534-64135556 GGTGGTTGGGGATGGTGGGGAGG + Intergenic
992027282 5:72682444-72682466 GTTGGATGTGCATGGTGGGGAGG + Intergenic
995598477 5:113772144-113772166 GGTGCTTCTTGATGGCGGTGGGG + Intergenic
997823630 5:137087573-137087595 GGGGCCTCTGCATGGCAGGGAGG + Intronic
998183816 5:139963823-139963845 TGAGGTTCTGCATGCTGGGGTGG - Intronic
1000368250 5:160510793-160510815 GGTGGTGCTGCTGGGCGCGGTGG - Intergenic
1002721001 5:181261441-181261463 GCTGGTTCTAGATGGTGGGGGGG + Intergenic
1005938902 6:30546257-30546279 GGTGGTTTTGCAGGGCAGGGTGG - Exonic
1006520272 6:34567309-34567331 GGTGCTTCGGCTGGGCGGGGGGG - Intergenic
1006954155 6:37852190-37852212 AGTGGTTCTCCATGGGGGTGAGG + Intronic
1008947955 6:57119660-57119682 GGAGGTTTTGCATGGAGGGGTGG - Intronic
1014534139 6:122596243-122596265 GATGGTTCTGCATGACAGGCTGG - Intronic
1017748865 6:157471427-157471449 GGGGGTTCTGGATGGGGAGGGGG - Intronic
1018272642 6:162096738-162096760 CATAGTTCTGCATGGCTGGGAGG - Intronic
1019491786 7:1317537-1317559 GGTGGTTCTTCATGCTGGTGAGG - Intergenic
1022404784 7:30078706-30078728 GCTGCTTCTCCATGGCAGGGAGG - Exonic
1022411152 7:30139654-30139676 GGCTGTTCTGCATGGTGGAGAGG - Intronic
1023710143 7:42983502-42983524 GGTGGTTCTGAAGGCTGGGGTGG + Intergenic
1026710041 7:72729716-72729738 GGTAGTTCTGCCTGTCGGGAGGG - Intronic
1027001308 7:74656742-74656764 GGTGGTACTGGGTGGGGGGGCGG + Intergenic
1031293681 7:119973859-119973881 CATAGTTCTGCATGGCTGGGAGG + Intergenic
1034940189 7:155225648-155225670 TGTGCTTCTGGATGGCAGGGAGG - Intergenic
1035106368 7:156444942-156444964 GGTGGCTGAGCATGGCGGGCCGG - Intergenic
1035679329 8:1476677-1476699 GGTGGGTCTGCATAACGGGCTGG - Intergenic
1037993739 8:23338568-23338590 GGCAGTGCTGCATGGCGGGAGGG + Intronic
1040981732 8:53251641-53251663 GGCGGCTCTGCGGGGCGGGGCGG + Exonic
1044854236 8:96458151-96458173 GATGGGTCTGCGTGGCGGGGTGG - Intergenic
1048325379 8:133435023-133435045 GGTGATTCAGCATGGTGGGCAGG + Intergenic
1049814189 8:144590549-144590571 GGTGGTTCTGCAGGCTGTGGAGG - Intronic
1056771969 9:89484146-89484168 GGTGGGCCTGCAGGGCGGGGTGG - Intronic
1056791083 9:89625729-89625751 GGTGGTCCAGGATGGAGGGGAGG + Intergenic
1057873616 9:98736277-98736299 GGTGCTTCTGCTTGGCAGGTTGG - Exonic
1058835443 9:108855507-108855529 GGAGGATCTTCATGGCGGTGCGG + Exonic
1059378842 9:113907691-113907713 GGTGTTTCTGCATCGCTGGGAGG + Intronic
1060982671 9:127802812-127802834 GGCGGTGCTGATTGGCGGGGGGG + Intronic
1062280666 9:135750335-135750357 GGTGGGTCTGCATGGTGAGTGGG + Intronic
1062280709 9:135750516-135750538 GGTGGGGCTGTATGGAGGGGTGG - Intronic
1062391554 9:136335950-136335972 GATGGTCCTGGATGGCAGGGAGG - Exonic
1186835625 X:13434675-13434697 AGTGGTTTGGCATGGGGGGGAGG + Intergenic
1192233358 X:69280873-69280895 GGTGGGTCTGCCTGGAGGAGAGG - Intergenic
1194050991 X:89068901-89068923 GGTGGTTTTGCAAGGCATGGTGG - Intergenic
1200034641 X:153319531-153319553 GGTGGTTGGCCATGGCTGGGTGG + Intergenic
1202584532 Y:26409276-26409298 GGGGGTTGTTCAGGGCGGGGTGG + Intergenic