ID: 1081620869

View in Genome Browser
Species Human (GRCh38)
Location 11:44618574-44618596
Sequence GTGGTTCTGCATGGCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081620853_1081620869 17 Left 1081620853 11:44618534-44618556 CCTCTGTAGGGGCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1081620869 11:44618574-44618596 GTGGTTCTGCATGGCGGGGTGGG 0: 1
1: 0
2: 1
3: 28
4: 344
1081620861_1081620869 2 Left 1081620861 11:44618549-44618571 CCGGGCTGGGACTGGGGGGCTCT 0: 1
1: 0
2: 2
3: 44
4: 393
Right 1081620869 11:44618574-44618596 GTGGTTCTGCATGGCGGGGTGGG 0: 1
1: 0
2: 1
3: 28
4: 344
1081620852_1081620869 18 Left 1081620852 11:44618533-44618555 CCCTCTGTAGGGGCTTCCGGGCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1081620869 11:44618574-44618596 GTGGTTCTGCATGGCGGGGTGGG 0: 1
1: 0
2: 1
3: 28
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081620869 Original CRISPR GTGGTTCTGCATGGCGGGGT GGG Intronic
900959271 1:5909034-5909056 GTGCTTCTGCGTGGCTGGGGAGG - Intronic
901649245 1:10734029-10734051 GTGGCTCTGCCTGGTTGGGTCGG - Intronic
902506191 1:16940015-16940037 GTGGGCCTGCATGGCGCCGTCGG - Exonic
904559518 1:31387206-31387228 GTGGTTGTGCCTGGGGGTGTGGG - Intergenic
905124516 1:35707757-35707779 CCGGGTCTGCAGGGCGGGGTGGG - Intergenic
905939691 1:41853335-41853357 GTAGTTCTGCATGGCTGGGGAGG + Intronic
907631121 1:56082957-56082979 ATGGTTCTGCAGGAAGGGGTTGG - Intergenic
908211748 1:61907144-61907166 ATGGTTCTGTATGGCTGGGGCGG - Intronic
908814097 1:68013893-68013915 ACGGTTCTGCATGGCTGGGGAGG - Intergenic
909581157 1:77236807-77236829 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
909757171 1:79240760-79240782 ATGGTTCTGCATAGCTGGGGAGG + Intergenic
910612941 1:89164776-89164798 GTGGTTTGGCTTGGAGGGGTGGG + Exonic
911023898 1:93416593-93416615 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
911343635 1:96671030-96671052 GTAGTTCTGCATGGCTGGGGAGG + Intergenic
912763129 1:112386396-112386418 GTGGTTGGGCATGCAGGGGTGGG + Intergenic
913959491 1:143327718-143327740 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic
913972415 1:143424563-143424585 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
914053850 1:144153291-144153313 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic
914066797 1:144250176-144250198 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
914112356 1:144716178-144716200 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic
914125296 1:144813074-144813096 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
914386644 1:147175645-147175667 ATAGTTCTGCATGGCTGGGGAGG - Intronic
914754167 1:150553660-150553682 GAGGTTCTGCTTGGGGGGATGGG - Exonic
915130584 1:153693097-153693119 GTGGATCTTCAGGGCTGGGTAGG - Exonic
916147619 1:161754530-161754552 ATGGTTCTGCATGGTTGGGGAGG + Intronic
920443329 1:205996735-205996757 TTGGTTCCGCATGGCTGGGGAGG + Intronic
921375079 1:214465048-214465070 GTTGATCTGTTTGGCGGGGTGGG - Intronic
921592493 1:217021033-217021055 GTGTGTATGCATGGCAGGGTTGG - Intronic
922345250 1:224691017-224691039 GTGGTTCTGAAAGCAGGGGTTGG + Intronic
1062770602 10:97524-97546 ACAGTTCTGCATGGCTGGGTAGG + Intergenic
1064011162 10:11737577-11737599 CTAGTTCTGCATGGCTGGGGAGG + Intergenic
1066779394 10:38927466-38927488 ATGGTTCCACATGGCTGGGTAGG + Intergenic
1067523667 10:47026123-47026145 ATGGTTCTGCAGGGCAGCGTGGG + Intergenic
1068519252 10:58061263-58061285 ATGGTTCTGCATGGCTGGGGAGG + Intergenic
1068676671 10:59776675-59776697 GAGGTTCTCCATGGCTGGGGAGG + Intergenic
1068908976 10:62358230-62358252 ATGGTTCTACATGGCTGGGGAGG + Intergenic
1069057455 10:63859640-63859662 ATGGTTCTGCAGGGCTGGGGAGG + Intergenic
1069577679 10:69542549-69542571 ATGGTTCTGCAGGGCTGGGGAGG + Intergenic
1069842172 10:71346792-71346814 GTGGTTCTGCCTGCAGGGGCAGG - Intronic
1070324601 10:75379915-75379937 GTGCTTCTTCCAGGCGGGGTGGG + Intergenic
1073420989 10:103423526-103423548 GTGGTTCTGCACTGCAGGGCAGG + Exonic
1073591714 10:104763966-104763988 ATAGTTCTGCATGGCTGGGGAGG - Intronic
1074783192 10:116817102-116817124 GTAAATCTGCATGGTGGGGTGGG - Intergenic
1077205191 11:1338648-1338670 GCAGTTCTGCATGGCTGGGGAGG - Intergenic
1077298645 11:1837475-1837497 GTGGTCCTGCAGGGCGGCCTGGG - Exonic
1078101701 11:8333989-8334011 GTGGGCCTGCATGGCAGGATGGG + Intergenic
1078390334 11:10931293-10931315 GTGGTGCTGGGGGGCGGGGTCGG + Intergenic
1079852780 11:25558251-25558273 ACAGTTCTGCATGGCTGGGTAGG + Intergenic
1081032261 11:38098816-38098838 ATGGTTCTGCATGGCTTGGGAGG + Intergenic
1081165487 11:39803781-39803803 ACAGTTCTGCATGGCTGGGTAGG + Intergenic
1081460179 11:43265560-43265582 GTGGTTTTGCATTTCAGGGTTGG - Intergenic
1081620869 11:44618574-44618596 GTGGTTCTGCATGGCGGGGTGGG + Intronic
1082742723 11:56928686-56928708 GTAGTTCTGCATGGTGGGTAGGG - Intergenic
1083496333 11:63057503-63057525 ACAGTTCTGCATGGCGGGGGAGG + Intergenic
1084300258 11:68245225-68245247 ACAGTTCTGCATGGCGGGGGAGG - Intergenic
1084719492 11:70895201-70895223 GCGGTTCTCCAAGGCGGGGTAGG + Intronic
1085200934 11:74701799-74701821 ATGGTTTTGGCTGGCGGGGTGGG - Intronic
1085228739 11:74946537-74946559 ACGGTTCTGCATGGCTGGGGAGG - Intronic
1085340795 11:75730226-75730248 CTGGTTCTGCCTGGCTGGGAAGG - Intronic
1086772202 11:90780551-90780573 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1087574910 11:99977504-99977526 ATGGTTCTGCATGGCTGAGAAGG + Intronic
1091232789 11:133999428-133999450 GCGGCTCTGCATGGTGGGGTGGG - Intergenic
1092618036 12:10233555-10233577 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1094325736 12:29236467-29236489 ATGGTTCCGCATGGCTGGGGAGG + Intronic
1095966797 12:47873308-47873330 ATGGTTCTGCATGGATGGGGAGG - Intronic
1096543364 12:52321082-52321104 GTGGTGATGCATGGGGGGCTGGG + Exonic
1096574322 12:52543287-52543309 GTGGTTCTGGAAGGTGGGATAGG + Intergenic
1098522792 12:71452170-71452192 GTGGCTCTGCATGGAATGGTGGG + Intronic
1099914285 12:88872812-88872834 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1100127940 12:91453248-91453270 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1100367907 12:93938302-93938324 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1101231642 12:102747552-102747574 ACAGTTCTGCATGGCTGGGTAGG + Intergenic
1101239770 12:102826126-102826148 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1101382415 12:104225677-104225699 ATAGTTCTGCATGGCTGGGGAGG - Intronic
1102449145 12:113027586-113027608 GAGATTCTTCATGGCAGGGTGGG - Intergenic
1102710926 12:114926064-114926086 ATGGTTCTGCACTGAGGGGTAGG - Intergenic
1103051043 12:117779777-117779799 ATAGTTCTGCATGGCTGGGGAGG - Intronic
1103269118 12:119657493-119657515 GTGGTTCTGCATGGCATGGCGGG + Intergenic
1103271831 12:119679958-119679980 GTGGTTCAGCATGACGTGATTGG - Exonic
1103520671 12:121535756-121535778 GTGTTTCTGCAAGGAAGGGTGGG - Intronic
1104178378 12:126354140-126354162 GTGGTTCTACATGGCTGGGGTGG + Intergenic
1104212319 12:126700831-126700853 GTAGTTCAGCATGGCTGGGGAGG - Intergenic
1104635233 12:130434443-130434465 GTGGTTTTGCAGGTCCGGGTAGG - Intronic
1106009204 13:25801798-25801820 ATAGTTCTGCATGGCTGGGGAGG + Intronic
1107069650 13:36256331-36256353 ATGGTTCTGCATGGCTGGGGAGG + Intronic
1107084531 13:36412336-36412358 GAAGTTCTGCATGGCTGGGGAGG + Intergenic
1107155935 13:37166972-37166994 ACGGTTCTGCATGGCTGGGGAGG - Intergenic
1108256618 13:48617626-48617648 GTGTTGCTGCAGGGCTGGGTGGG - Intergenic
1108570131 13:51741458-51741480 GTGGGTCTGAATGCCAGGGTGGG + Intronic
1109195388 13:59372619-59372641 GTGGAACTGCATGGAGGGATGGG + Intergenic
1109365778 13:61354707-61354729 ATGGTTCTGGATGGCTGGGGAGG - Intergenic
1109771916 13:66986069-66986091 ATAGTTCTGCATGGCTGGGGAGG + Intronic
1110205444 13:72906801-72906823 GTGGTTTTGCAGGGGGAGGTGGG + Intronic
1111426219 13:88086742-88086764 GTGGTTTTGCAAGGCAGGGAGGG + Intergenic
1112694760 13:101935641-101935663 ATGGTTCCGCATGGCTGGGGAGG - Intronic
1113221973 13:108114967-108114989 ATAGTTCTGCATGGCTGGGAAGG - Intergenic
1113512069 13:110864434-110864456 ATGGCTCTGCATGGCTGGGGAGG + Intergenic
1114170678 14:20269879-20269901 GTGGTTTGGCATGAAGGGGTGGG - Intronic
1115623814 14:35169474-35169496 AAGGTTCTGCATGGCTGGGGAGG + Intronic
1116098762 14:40407402-40407424 ATTGTTCTGCATGGCTGGGGAGG + Intergenic
1116507515 14:45703352-45703374 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1117085646 14:52197399-52197421 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1118048817 14:62004147-62004169 ATAGTTCTGCATGGCTGGGGAGG + Intronic
1118212474 14:63778298-63778320 ACGGTTCTGCATGGCTGGGGAGG - Intergenic
1119165130 14:72486195-72486217 ATGGTTCAGCATGGCTGGGGAGG - Intronic
1120155002 14:81083798-81083820 ACGGTTCTGCATGGCTGGGGAGG + Intronic
1120558151 14:85956106-85956128 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1121369427 14:93343253-93343275 ATAGTTCTGCATGGCTGGGGAGG + Intronic
1121430372 14:93882209-93882231 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1121684322 14:95821824-95821846 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1122766331 14:104073615-104073637 GTGCTTGTGCATGTCGGGATGGG + Intergenic
1122870097 14:104634546-104634568 GTGGGACAGCTTGGCGGGGTGGG - Intergenic
1202929063 14_KI270725v1_random:23027-23049 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
1123423298 15:20148469-20148491 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic
1123532519 15:21154990-21155012 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic
1125278425 15:38018026-38018048 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1125503560 15:40253659-40253681 GTGGCTGTGCAGGGCAGGGTGGG + Intronic
1126238839 15:46417569-46417591 TTGGTTCTACATGGCTGGGGAGG - Intergenic
1127557939 15:60106675-60106697 GCAGTTCTGCATGGCTGGGGAGG + Intergenic
1128868999 15:71138143-71138165 ATAGTTCTGCATGGCTGGGGAGG + Intronic
1129590396 15:76909761-76909783 ACGGTTCTGCATGGCTGGGGAGG - Intergenic
1130976296 15:88778006-88778028 GTGATTCAGCATGTCTGGGTAGG + Intergenic
1131200669 15:90393152-90393174 GTGGTTCAGTAGGTCGGGGTGGG + Intronic
1134874492 16:17684921-17684943 ATAGTTCTGCATGGCTGGGAAGG - Intergenic
1135283711 16:21174765-21174787 GTGGTTTTCTTTGGCGGGGTGGG + Intronic
1136599867 16:31277903-31277925 GTGGGTCTGCATGGTGGAGGAGG + Intronic
1136861520 16:33707133-33707155 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
1137932494 16:52602250-52602272 GCAGTTCTGCATGGCTGGGGAGG - Intergenic
1138799956 16:60015642-60015664 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1140132345 16:72174630-72174652 ATAGTTCTGCATGGCTGGGGAGG + Intronic
1140151621 16:72373080-72373102 GTGGTGCTGTATGGAGGGGAGGG - Intergenic
1140510116 16:75501163-75501185 AGAGTTCTGCATGGCTGGGTAGG - Intergenic
1141017208 16:80461726-80461748 TTAGTTCTGCATGGCTGGGGAGG - Intergenic
1141043531 16:80693123-80693145 GTGGGGGTGGATGGCGGGGTGGG + Intronic
1141733918 16:85839932-85839954 GTGGTCCTGCATGGTCGGGCAGG - Intergenic
1203123020 16_KI270728v1_random:1555324-1555346 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
1144351804 17:14403687-14403709 GCTGTTCTGCATGGCTGGGGAGG - Intergenic
1144559020 17:16306470-16306492 CTTGTTCTGCATGGAAGGGTGGG + Intronic
1146341163 17:32020933-32020955 GTGTTCCGGCCTGGCGGGGTGGG + Intronic
1148168466 17:45500717-45500739 GGTGTTATGCATGGCGGGGAAGG + Intergenic
1148557455 17:48587022-48587044 GTGGTAATGGTTGGCGGGGTGGG - Intronic
1150576908 17:66438669-66438691 ATGGTTCTGCATGGCTGGGGAGG + Intronic
1150582172 17:66484018-66484040 TTAGTTCTGCATGGCTGGGGAGG + Intronic
1151867272 17:76812342-76812364 GTGGTTGTGTATGGCGTCGTGGG + Intergenic
1151934366 17:77253012-77253034 GTGGTTCTGCCTGGCTTGCTTGG + Intergenic
1152564081 17:81092413-81092435 GTGGGGCTGCAGGGAGGGGTGGG + Intronic
1152654108 17:81512183-81512205 TGGGTTCTGCGTTGCGGGGTGGG - Intronic
1152892371 17:82889952-82889974 GTGGCTCTGCAGGGTGGGGCGGG + Intronic
1157316490 18:46594167-46594189 GTGGAGCTGCTTGGCGGGGTTGG + Intronic
1159204429 18:65232147-65232169 ATGGTTCTGCATGGCTGGGGAGG - Intergenic
1159245137 18:65795994-65796016 ACAGTTCTGCATGGCTGGGTAGG - Intronic
1159703816 18:71662126-71662148 ATGGTTCTGCATGGCTGAGGAGG - Intergenic
1160362733 18:78297445-78297467 GTGGTTCTGTGTGGCCAGGTGGG - Intergenic
1162110177 19:8395792-8395814 GTGGTTCTGCCTTATGGGGTGGG - Intronic
1162175926 19:8830227-8830249 TCAGTTCTGCATGGCGGGGGAGG - Intronic
1162518852 19:11167022-11167044 GTGGTTGTGCAGGGCCTGGTGGG + Intronic
1163349519 19:16767101-16767123 ATAGTTCTGCATGGCTGGGAAGG + Intronic
1165228393 19:34370222-34370244 GTGATTCTGCAGGGGTGGGTTGG + Intronic
1165361853 19:35341685-35341707 GTGCATCTGCATGGCGGGCAGGG - Exonic
1165395852 19:35563263-35563285 GTCGTTCTGTGTGGTGGGGTGGG + Exonic
1167197987 19:48043911-48043933 GGGGAACTGCATGGAGGGGTGGG + Exonic
1168137401 19:54360636-54360658 CTGGCTCTGCTTGGCTGGGTGGG - Intronic
1168160676 19:54508446-54508468 CTGGCTCTGCTTGGCTGGGTGGG + Intronic
1202693326 1_KI270712v1_random:105949-105971 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic
926684714 2:15690001-15690023 GTGGTTTCACGTGGCGGGGTGGG - Intergenic
927389691 2:22581574-22581596 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
927697189 2:25246568-25246590 GTGGATCTGCCTGGCGGGCAGGG + Intronic
929245368 2:39696365-39696387 GTGGTTCTGTATGGCGAATTGGG + Intronic
929562132 2:42962520-42962542 GTGGTACTGGCTGGAGGGGTTGG + Intergenic
929996524 2:46829474-46829496 GTGGTGCTTCCTGGCGGGGGTGG + Intronic
932571468 2:72940609-72940631 TTGGTTCTGCAGGGAAGGGTGGG + Intergenic
933047312 2:77555430-77555452 ATAGTTCTGCATGGCTGGGGTGG - Intronic
933445615 2:82376794-82376816 ATGGTTGTGCATGGCTGGGGAGG - Intergenic
933953242 2:87348610-87348632 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
934177108 2:89585501-89585523 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
934287415 2:91659860-91659882 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
934459900 2:94208261-94208283 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
935327230 2:101948099-101948121 ATGGTTCTGCATGGATGGGGAGG + Intergenic
935796665 2:106648301-106648323 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
937030505 2:118735338-118735360 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
938773773 2:134523232-134523254 GTGGGTCTGCAGGTGGGGGTCGG + Intronic
939508181 2:143074843-143074865 GTGGTTCCACATGGCAGGGGAGG - Intergenic
939686470 2:145206611-145206633 ATGGTTCAGCATGGCTGGGGCGG + Intergenic
939827797 2:147036152-147036174 ACGGTTCTGCATGGCTGGGGAGG + Intergenic
941227353 2:162866027-162866049 ATGGCTCTGCATGGCTGGGGAGG + Intergenic
941323910 2:164089039-164089061 ACGGTTCTGCATGGCTGGGCTGG - Intergenic
941607819 2:167621907-167621929 TTAGTTCTGCATGGCTGGGAAGG - Intergenic
942664622 2:178304302-178304324 ACGGTTCTGCATGGCTGGGGAGG + Intronic
943372264 2:187029319-187029341 ATAGTTCTGCATGGCTGGGAAGG - Intergenic
944289589 2:197990478-197990500 GTGGTTCCACATGGCTGGGGAGG + Intronic
946142172 2:217700687-217700709 GCAGTTCTGCATGGCTGGGGAGG - Intronic
946247505 2:218396132-218396154 GTCGTTCCGCCTGGCGGGGAGGG - Exonic
946322745 2:218963027-218963049 GTGGTGCTGAATGGCGCGCTCGG + Intergenic
947319137 2:228897118-228897140 TTAGTTCTGCATGGCTGGGGAGG - Intronic
948794665 2:240396170-240396192 GTTGTCCTGAATGGCGGGGTTGG - Intergenic
1168846541 20:948996-949018 ATAGTTCTGCATGGCTGGGGGGG + Intergenic
1170704017 20:18728469-18728491 GTGGTTCTGCAAGTCTGGGTGGG + Intronic
1170836380 20:19888203-19888225 ATGGTTCTGGAAGGAGGGGTGGG + Intronic
1171390810 20:24800512-24800534 ATGGGTCTGCAGGGCGGGGGTGG - Intergenic
1173434499 20:43020599-43020621 GTGGTGGGGCATGGCAGGGTTGG - Intronic
1173486956 20:43448183-43448205 GTGGTTCTGCATGGCAGGGGAGG + Intergenic
1173749261 20:45463857-45463879 ATGGTTCTTCATGGCTGGGGAGG - Intergenic
1174273734 20:49388272-49388294 GTGCTTCAGCTTAGCGGGGTTGG + Intronic
1174756263 20:53161513-53161535 ACAGTTCTGCATGGCTGGGTAGG + Intronic
1176591082 21:8651615-8651637 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
1176688896 21:9880863-9880885 GTAGTTCTACATGGCTGGGGAGG + Intergenic
1176889268 21:14294566-14294588 ATAGTTCTGCGTGGCTGGGTAGG + Intergenic
1177233340 21:18351634-18351656 ATAGTTCTGCATGGCTGGGGAGG - Intronic
1178024171 21:28446193-28446215 ATGGTTCCACATGGCTGGGTGGG - Intergenic
1178884465 21:36474605-36474627 GTTGTTCTGGGTGGCGGGATGGG - Intronic
1180273910 22:10628648-10628670 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
1180927440 22:19566019-19566041 GTGGTTCAGAATGGCAGGGCTGG + Intergenic
1180951312 22:19721810-19721832 CTGGTTCTCCACTGCGGGGTGGG - Exonic
1181356306 22:22298238-22298260 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic
1182413816 22:30208341-30208363 AAGTTTCTGGATGGCGGGGTGGG - Intergenic
1183751837 22:39725338-39725360 GTGATTCTGCAGGGAGGTGTTGG - Intergenic
1184215433 22:43063816-43063838 GTGTTTCTGGATGGCGACGTTGG + Exonic
950562715 3:13744354-13744376 ACAGTTCTGCATGGCTGGGTAGG + Intergenic
950646180 3:14378179-14378201 GTGTTTCTGCTTGGGGGTGTGGG - Intergenic
950852123 3:16072071-16072093 ACAGTTCTGCATGGCTGGGTAGG + Intergenic
952656911 3:35797658-35797680 ATAGTTCTTCATGGCTGGGTAGG + Intergenic
952960387 3:38585747-38585769 GTGGGACTGCATGGAGGTGTCGG - Exonic
953331984 3:42061338-42061360 GTGGGTGTGCGTGGGGGGGTGGG - Intronic
956302594 3:67788744-67788766 ATGGTTCCGCATGGCTGGGGAGG - Intergenic
957483811 3:80832119-80832141 GTGGTTAGGGTTGGCGGGGTTGG + Intergenic
957522507 3:81337471-81337493 ACGGTTCTGCATGGCTGGGGAGG - Intergenic
958047799 3:88305644-88305666 ATAGTTCTGCATGGCTGGGGCGG - Intergenic
959593212 3:108101712-108101734 GCAGTTCTGCATGGCTGGGGAGG + Intergenic
959935472 3:112023929-112023951 ATGGTTCTGAATGGCTGGGGAGG - Intergenic
959986992 3:112585108-112585130 GCAGTTCTGCATGGCTGGGGAGG + Exonic
960509316 3:118529479-118529501 GCAGTTCTGCATGGCTGGGGAGG + Intergenic
962559686 3:136592443-136592465 GCAGTTCTGCATGGCTGGGGAGG - Intronic
963386075 3:144597296-144597318 ATGGTTCAGCATGGCTGGGGAGG + Intergenic
963388972 3:144632933-144632955 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
964239353 3:154573869-154573891 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
964358543 3:155871243-155871265 GTGTGTCTGCGTGTCGGGGTGGG + Intronic
964934146 3:162060595-162060617 ATGGTTCTACATGGCTGGGTAGG + Intergenic
964966003 3:162494785-162494807 ACAGTTCTGCATGGCTGGGTAGG - Intergenic
964966280 3:162497115-162497137 GCAGTTCTGCATGGCTGGGGAGG + Intergenic
965127744 3:164651158-164651180 ATGGTTCTGCATGGCTGGGGAGG - Intergenic
966333245 3:178839576-178839598 ATGGTTCTGCATGGCTGGGGAGG + Intronic
966943566 3:184761866-184761888 GTGTCCCTGCATGGAGGGGTGGG + Intergenic
968519608 4:1029550-1029572 GAGGCTCAGCATGGCGGGGCAGG + Intergenic
969169267 4:5346844-5346866 ACGGTTCTTCATGGCCGGGTAGG + Intronic
969169386 4:5347869-5347891 ATAGTTCTGCATGGCTGGGGAGG - Intronic
969245246 4:5927723-5927745 ATAGTTCTGCATGGCTGGGGAGG - Intronic
969397225 4:6930089-6930111 GTGATTTTGCAGGGCGGTGTTGG + Intronic
970270836 4:14345569-14345591 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
970387314 4:15568721-15568743 GTGCCTCTGCATGGCAGGGCTGG - Intronic
971411671 4:26379432-26379454 TTAGTTCTGCATGGCTGGGGAGG + Intronic
971552280 4:27973047-27973069 ATGGTTCCGCATGGCTGGGGAGG + Intergenic
971599075 4:28569472-28569494 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
972101865 4:35430641-35430663 ATTGTTCTGCATGGCTGGGGAGG - Intergenic
973172584 4:47163941-47163963 GCAGTTCTGCATGGCTGGGGAGG + Intronic
975284898 4:72606179-72606201 ACGGTTCTGCATGGCTGGGGAGG - Intergenic
976479533 4:85524209-85524231 GTGGTACAGAATGGTGGGGTTGG - Intronic
978771618 4:112462554-112462576 ATGGTTCAGCATGGCTGGGGAGG - Intergenic
979125838 4:116970313-116970335 ATGGTTCTGCATGGCTGGAGAGG - Intergenic
980352281 4:131698677-131698699 GTAGTTCTACATGGCTGGGGAGG + Intergenic
981171993 4:141636368-141636390 GTGTTCCTGCAGGGCGGGGCTGG + Intergenic
982678429 4:158402415-158402437 GTAGTTCAGCATGGCTGGGGAGG + Intronic
983006540 4:162491440-162491462 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
983069865 4:163254893-163254915 ACGGTTCTGCATGGCTGGGGAGG + Intergenic
983317317 4:166148880-166148902 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
984414963 4:179446373-179446395 ATGGTTCTGCATTGCTGGGGAGG - Intergenic
984453330 4:179931725-179931747 TTAGTTCTGCATGGCTGGGGAGG - Intergenic
986798252 5:11233060-11233082 ACGGTTCTGCATGGCTGGGGAGG - Intronic
987878668 5:23712343-23712365 GTGGCTCTGCAGGGCTGGGCGGG - Intergenic
987947426 5:24629789-24629811 ATAGTTCTGCATGGCTGGGGAGG - Intronic
988263763 5:28926356-28926378 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic
989144360 5:38234138-38234160 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
990327425 5:54692173-54692195 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
991489822 5:67171629-67171651 GTAGTTCAGCATGGCTGGGGAGG - Intergenic
993657377 5:90594413-90594435 ATGGTTCTGAATGGCTGGGGAGG - Intronic
995412857 5:111878295-111878317 ATAGTTCTGCATGGCAGGGAAGG + Intronic
995682865 5:114740322-114740344 GTGGTTCTGCATGGATTGGTAGG - Intergenic
995698290 5:114904717-114904739 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
995913228 5:117212864-117212886 GTAGTGCAGCATGGAGGGGTGGG - Intergenic
995995484 5:118293138-118293160 TTTGTTCTGCATGGCTGGGGAGG - Intergenic
996215418 5:120859815-120859837 GTAGTTCTACATGGCTGGGGAGG + Intergenic
998183815 5:139963822-139963844 GAGGTTCTGCATGCTGGGGTGGG - Intronic
998871619 5:146558165-146558187 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
998873215 5:146573541-146573563 ATGGTTCTGCATGGCTGGGGAGG - Intergenic
1000103679 5:158038505-158038527 TAGGTTCTGCATGGCTGGGGAGG - Intergenic
1001926120 5:175638524-175638546 GAGGAACTGCATGGCTGGGTTGG - Intergenic
1002844433 6:934455-934477 GTGCTTCTGCATTGGGGGATTGG + Intergenic
1003960415 6:11203865-11203887 GTGGTTCTGGATGGGATGGTGGG + Intronic
1004602112 6:17160207-17160229 GTAGTTCTGCATGGCTGGAGAGG - Intergenic
1004821991 6:19377048-19377070 GTGGTTCTGCTTGTCTGGATAGG - Intergenic
1005718823 6:28580799-28580821 GTGTTTGTGCTTGGGGGGGTGGG - Intronic
1005938901 6:30546256-30546278 GTGGTTTTGCAGGGCAGGGTGGG - Exonic
1006395085 6:33781983-33782005 GTGTTTCTGCATGCTGGGGAAGG + Intronic
1007003414 6:38336384-38336406 ATAGTTCTGCATGGCTGGGAAGG + Intronic
1008179012 6:48304751-48304773 ATGGTTCTGCAGGGCTGGGGAGG + Intergenic
1008947954 6:57119659-57119681 GAGGTTTTGCATGGAGGGGTGGG - Intronic
1009377787 6:62993496-62993518 GTGGTTCTGCAGGCCTGGGGAGG + Intergenic
1009889780 6:69666600-69666622 ATAGTTCTGCATGGCTGGGAAGG - Intergenic
1011221029 6:85054745-85054767 ATGGTTCTGCATTGCTGGGGAGG + Intergenic
1013871301 6:114764782-114764804 CTAGTTCTGCATGGCTGGGGAGG + Intergenic
1014861387 6:126471379-126471401 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1015480452 6:133702697-133702719 GCAGTTCTGCATGGCTGGGGAGG + Intergenic
1016020619 6:139233676-139233698 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1016291815 6:142535651-142535673 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1016374941 6:143410517-143410539 ATGGTTCTGCATGGCTGGGGAGG - Intergenic
1017675031 6:156804501-156804523 ATAGTTCTGCATGGCTGGGGAGG + Intronic
1017873249 6:158503466-158503488 GGGGTTCTGCATGGGCGGGCAGG - Exonic
1019352328 7:560258-560280 GTGATTCTGCCTGGCTGGGGAGG - Intronic
1020743447 7:12051543-12051565 ATGGTTCTGCATGTCTGGGAAGG + Intergenic
1021419248 7:20426309-20426331 GCAGTTCTGCATGGCTGGGGAGG - Intergenic
1021570855 7:22063653-22063675 GTAGTTCTGCGTGGCTGGGGAGG - Intergenic
1021573162 7:22085052-22085074 ATGGTTCTGCAGGGCTGGGGAGG + Intergenic
1021617586 7:22518975-22518997 ATAGTTCTGCATGGCTGGGGAGG - Intronic
1022693552 7:32682284-32682306 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1022800696 7:33774619-33774641 AAAGTTCTGCATGGCTGGGTAGG - Intergenic
1022927180 7:35068458-35068480 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1025861588 7:65335910-65335932 GTAGTTCAGCATGGCCGGGAAGG - Intergenic
1025861949 7:65338596-65338618 ACGGTTCTGCATGGCTGGGGAGG - Intergenic
1028041622 7:86060905-86060927 ATAGTTCTGCATTGCTGGGTAGG + Intergenic
1028375091 7:90137129-90137151 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1029544105 7:101201346-101201368 GTGTTTGTGCATGGCGGGGGAGG - Intergenic
1030487883 7:110193955-110193977 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1033905549 7:146197895-146197917 ACAGTTCTGCATGGCTGGGTAGG + Intronic
1034466494 7:151232845-151232867 GTCGTTCTGCGAGGCGGGGTCGG - Exonic
1035589619 8:802572-802594 CAGGGGCTGCATGGCGGGGTGGG + Intergenic
1036731864 8:11272720-11272742 GTGGTCTGGAATGGCGGGGTTGG - Intergenic
1037081820 8:14796971-14796993 GTGGTTCAGCACGGCTGGGGAGG - Intronic
1037130200 8:15399279-15399301 GTAGTTCCGCATGGCTGGGGAGG - Intergenic
1037493815 8:19420093-19420115 ATAGTTCTGCATGGCTGGGGAGG - Intronic
1037556683 8:20031907-20031929 ATGGTTCTGCATGGCTAGGGAGG + Intergenic
1037635585 8:20698915-20698937 ATGGTTCAGCATGGCGGGGGAGG + Intergenic
1041852220 8:62404635-62404657 ATGGTTCTGCAGGGCAGGGGAGG - Intronic
1041984956 8:63910399-63910421 ATGGTTCTACATGGCTGGGGAGG + Intergenic
1042173580 8:66016499-66016521 ATGGTTCTGCATTGCTGGGGAGG - Intergenic
1042441756 8:68835982-68836004 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1043708688 8:83385314-83385336 ATAGTTCTGCATGGCTGGGAAGG + Intergenic
1046710411 8:117505190-117505212 GTAGTTCTACATGGCTGGGGAGG - Intergenic
1046898607 8:119499746-119499768 ATAGTTCTGCATGGCTGGGGAGG - Intergenic
1047515290 8:125549028-125549050 ATGGTTCTGCATGGCTGGGGAGG + Intergenic
1048047949 8:130791038-130791060 GTGGTTCAGCACAGCTGGGTTGG + Intronic
1048094188 8:131273677-131273699 GTGGTCCTGCCTGAGGGGGTAGG - Intergenic
1048527429 8:135215963-135215985 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1048782631 8:138018239-138018261 ATAGTTCTGCATGGCTGGGAAGG - Intergenic
1050803929 9:9650256-9650278 ACGGTTCTGCATGGCTGGGGAGG - Intronic
1052511921 9:29433193-29433215 GTAGTTCTGCATTGCTGGGGAGG + Intergenic
1052522362 9:29563928-29563950 TTAGTTCTGCATGGCTGGGGAGG - Intergenic
1052768292 9:32663923-32663945 GTGGTTCTGCCTCTGGGGGTTGG - Intergenic
1053690402 9:40584069-40584091 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
1054301654 9:63385030-63385052 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
1056483430 9:87030126-87030148 CTGGTTCTGTATAGCAGGGTGGG - Intergenic
1056721815 9:89078597-89078619 GTGGTTCTGCATGGGGCAGGAGG + Intronic
1056902343 9:90611694-90611716 GTGGGCCTGCCTGGGGGGGTGGG - Exonic
1057867453 9:98692693-98692715 GTGGATCTGCATGGTGAGCTGGG - Intronic
1058263400 9:102866663-102866685 GTAGTTCTGCATGGCTGGGGAGG + Intergenic
1061102137 9:128500131-128500153 GTAGTTCTGCATGCTGCGGTTGG - Exonic
1061965029 9:134008646-134008668 GTGGCTTTGCAGGGAGGGGTGGG - Intergenic
1062280708 9:135750515-135750537 GTGGGGCTGTATGGAGGGGTGGG - Intronic
1203621099 Un_KI270749v1:130338-130360 GGGGTTGTTCAGGGCGGGGTGGG - Intergenic
1188305566 X:28557189-28557211 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1189409954 X:40761212-40761234 GTGGCTCTGCTAGGCTGGGTGGG - Intergenic
1191094736 X:56662121-56662143 GTAGTTCTGCATGGCTGGAGAGG - Intergenic
1191680594 X:63836125-63836147 GTAGTTCTTCATGGCTGGGGAGG - Intergenic
1192578063 X:72258584-72258606 GTGGTTCTGGAGGTGGGGGTAGG - Intronic
1193880698 X:86917625-86917647 GCAGTTCTGCATGGCTGGGGAGG - Intergenic
1194905833 X:99575529-99575551 ATGGTTCCGCATGGCTGGGGAGG - Intergenic
1196967690 X:121076446-121076468 GTAGTTCTGTATGGCTGGGGAGG - Intergenic
1196973727 X:121136963-121136985 GTGGTTCCACATGGCTGGGGAGG + Intergenic
1197558192 X:127983459-127983481 GTAGTTCTGCATGGCTAGGGAGG + Intergenic
1197912453 X:131498405-131498427 ATGGTTCTGCAGGGCTGGGGAGG + Intergenic
1199188142 X:144940077-144940099 GTGGTTGGGCATGGAGGGGTTGG - Intergenic
1199775966 X:151012384-151012406 ATAGTTCTGCATGGCTGGGGAGG + Intergenic
1199951938 X:152714490-152714512 GGGGATCTGGATGGGGGGGTGGG - Intergenic
1199957745 X:152753958-152753980 GGGGATCTGGATGGGGGGGTGGG + Intergenic
1200092811 X:153643745-153643767 GTGCTTGTGCGTGTCGGGGTGGG + Intronic
1202584533 Y:26409277-26409299 GGGGTTGTTCAGGGCGGGGTGGG + Intergenic