ID: 1081626226

View in Genome Browser
Species Human (GRCh38)
Location 11:44656893-44656915
Sequence TAGTGGCACTTTTGTTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081626226_1081626233 15 Left 1081626226 11:44656893-44656915 CCAAAGAAACAAAAGTGCCACTA 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1081626233 11:44656931-44656953 ACAGTCAATAAGATGTGGGCCGG No data
1081626226_1081626234 29 Left 1081626226 11:44656893-44656915 CCAAAGAAACAAAAGTGCCACTA 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1081626234 11:44656945-44656967 GTGGGCCGGAATAGAACTGCTGG No data
1081626226_1081626231 11 Left 1081626226 11:44656893-44656915 CCAAAGAAACAAAAGTGCCACTA 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1081626231 11:44656927-44656949 AGCCACAGTCAATAAGATGTGGG No data
1081626226_1081626230 10 Left 1081626226 11:44656893-44656915 CCAAAGAAACAAAAGTGCCACTA 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1081626230 11:44656926-44656948 GAGCCACAGTCAATAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081626226 Original CRISPR TAGTGGCACTTTTGTTTCTT TGG (reversed) Intergenic
900271867 1:1794485-1794507 CAGTGGCACTGGTGATTCTTGGG + Intronic
902826540 1:18978550-18978572 GAGTCGAACTTTTGATTCTTTGG + Intergenic
904257922 1:29268326-29268348 TAGGGGCAATTTTGTCTCCTAGG + Intronic
905529759 1:38668386-38668408 TAGATGCAGTTTTGTTTCTTGGG + Intergenic
907007054 1:50925461-50925483 TAGTGGGATTTTTTTTTTTTTGG - Intronic
909954148 1:81756972-81756994 TAGTGACACTTTGGTTTACTAGG + Intronic
910252819 1:85215895-85215917 TGGTGGCACATTTGTTAGTTTGG - Intergenic
910944192 1:92570827-92570849 TAATAGCACTTTGATTTCTTTGG + Intronic
911021359 1:93391253-93391275 TAATGGCCTTTTTGTCTCTTTGG - Intergenic
913670103 1:121089278-121089300 TATTAGCAGTTTTGTTTCTGTGG - Intronic
914021868 1:143876675-143876697 TATTAGCAGTTTTGTTTCTGTGG - Intergenic
914660352 1:149784624-149784646 TATTAGCAGTTTTGTTTCTGTGG - Intronic
914924198 1:151869809-151869831 TAGTGCTAGTTTTGTTTTTTTGG + Intergenic
916181922 1:162092571-162092593 CAGTGGTCTTTTTGTTTCTTTGG + Intronic
916582027 1:166117558-166117580 TAATGGCACTTATTTTTCTATGG + Intronic
917531244 1:175837027-175837049 TAAAGGAACTTTAGTTTCTTTGG + Intergenic
919056853 1:192581926-192581948 TATTGTCACTTTTTTTTTTTTGG + Intergenic
919159370 1:193808263-193808285 TGGTATCACTTCTGTTTCTTTGG - Intergenic
919807312 1:201387795-201387817 TCATGTTACTTTTGTTTCTTTGG - Intronic
920452512 1:206070465-206070487 TAGATGCATTTTTTTTTCTTTGG - Intronic
921618349 1:217298397-217298419 TAGGGGCACTTCTGTTTCTCAGG - Intergenic
924786571 1:247205135-247205157 CCGTGGCAGTTTTGTTTTTTGGG - Intergenic
1063079723 10:2754408-2754430 TAGTGCCATATTTGTTTCCTAGG + Intergenic
1063864595 10:10350477-10350499 TATTGGCACTCTTGGTTCTCAGG - Intergenic
1068276140 10:54799696-54799718 AAATGGCACTTTTATTTCATAGG + Intronic
1069453222 10:68533980-68534002 TACTGGCACCTTTGTCCCTTGGG - Intergenic
1070230798 10:74564934-74564956 CAGTGGCTCTGTTGCTTCTTAGG + Intronic
1071442418 10:85713419-85713441 GATTGGCATTTTTCTTTCTTGGG - Intronic
1080439684 11:32280492-32280514 TAGTTCCACTTTCATTTCTTGGG - Intergenic
1080690499 11:34553183-34553205 TATTGGGACTTCTGTTTCTGGGG - Intergenic
1081626226 11:44656893-44656915 TAGTGGCACTTTTGTTTCTTTGG - Intergenic
1082836278 11:57652807-57652829 TGGTTTCACTTTTGTTTTTTTGG - Intronic
1086740220 11:90358579-90358601 CACTGGCTCTCTTGTTTCTTGGG - Intergenic
1087017570 11:93568941-93568963 CATTGGCACTTCTGGTTCTTTGG - Intergenic
1088021761 11:105128630-105128652 TAGTACCAATTTTGTTTCTATGG - Intergenic
1089434262 11:118450484-118450506 GAGTAGCATTTGTGTTTCTTAGG + Intronic
1090916380 11:131167252-131167274 TAGTTGCAGTTCTTTTTCTTTGG + Intergenic
1091139231 11:133221126-133221148 TATTAGCACTTTTGAGTCTTTGG + Intronic
1091420137 12:330945-330967 TAGTGGCTGTTATGTTGCTTGGG - Intronic
1093195297 12:16123347-16123369 CAGTGGCAATTTTGTCCCTTAGG + Intergenic
1093229144 12:16521779-16521801 TATTTTCACTTTTCTTTCTTTGG - Intronic
1093872626 12:24310212-24310234 TTGTGTCACTTTGGTTTCTCAGG + Intergenic
1094437947 12:30442031-30442053 TAGTTGCACTCTTAATTCTTAGG + Intergenic
1095393452 12:41736312-41736334 TAGTACCACTTTTTTTTTTTTGG - Intergenic
1098652136 12:72986043-72986065 GAGTTTCACTTTTGTTGCTTAGG + Intergenic
1099747934 12:86731620-86731642 TTGTGGCACTTTGTTTCCTTAGG + Intronic
1100481593 12:94984530-94984552 TTGTTGCTTTTTTGTTTCTTTGG - Intronic
1100619495 12:96257425-96257447 TGTTTGCACATTTGTTTCTTAGG - Intronic
1100666917 12:96764659-96764681 TTGTGCCAATTATGTTTCTTTGG + Intronic
1102181441 12:110915592-110915614 TTGTGGCAGAGTTGTTTCTTTGG + Intronic
1102896781 12:116604577-116604599 TCGTGGGATTTTTGTTTATTTGG - Intergenic
1102936995 12:116905984-116906006 TTGTCCCACTTTTGTTTCCTGGG + Intergenic
1106294463 13:28398033-28398055 TATTGCCAATTTTTTTTCTTTGG - Intronic
1106501968 13:30337512-30337534 TAGTCATACTCTTGTTTCTTTGG - Intergenic
1107242340 13:38251586-38251608 TAGTGGCACAAGTGTTACTTGGG - Intergenic
1108800762 13:54092358-54092380 TGGTGGCAGTTCTGTTTCTATGG - Intergenic
1109085425 13:57965506-57965528 GAAAGGCACTCTTGTTTCTTTGG + Intergenic
1111264151 13:85785057-85785079 TCATGGCCCTTTTGCTTCTTTGG - Intergenic
1112155711 13:96815060-96815082 TAGTGGTACTTTTGTCACTGTGG - Intronic
1113295119 13:108951263-108951285 TAGTTGCACTTGGTTTTCTTGGG + Intronic
1116861757 14:50001159-50001181 TACCTGCACTTTTCTTTCTTAGG + Intronic
1117469474 14:56027588-56027610 TATGGGAACTTTTGTTTGTTAGG + Intergenic
1117841139 14:59861506-59861528 TAGGGGCACTGTTGTCTTTTAGG + Intronic
1118258845 14:64228830-64228852 TAGTGCCATTTTTGTTGCTTTGG - Intronic
1118845364 14:69544020-69544042 TAGTCGGGCTTTTCTTTCTTTGG - Intergenic
1120031574 14:79647160-79647182 GAGTGGCAATTTTGTTTTTCTGG + Intronic
1120557674 14:85949083-85949105 TTATGGCACTTTTGCTTCTCAGG - Intergenic
1120891102 14:89492065-89492087 TAGTTCAACTTTTGTTTTTTGGG - Intronic
1124663370 15:31569195-31569217 TACTGGTGCTTTTGTTTCTATGG - Intronic
1124962591 15:34409819-34409841 TTGTGGCACTCCTGCTTCTTGGG - Intronic
1124979216 15:34556041-34556063 TTGTGGCACTCCTGCTTCTTGGG - Intronic
1125295872 15:38202778-38202800 TATTGGCACTTTTGATTGTCAGG - Intergenic
1127241238 15:57117022-57117044 TAATGACACTTTTGTTTATGAGG + Intronic
1128986263 15:72223935-72223957 TCTTGGCTCTTTTATTTCTTCGG + Intronic
1129636713 15:77326411-77326433 TTTTGGCATTTCTGTTTCTTTGG - Intronic
1130374254 15:83313960-83313982 TAGAGAGACTTCTGTTTCTTTGG - Intergenic
1133907221 16:10033346-10033368 TAGCGGCACCTGTGTTTCCTGGG - Intronic
1137551501 16:49440645-49440667 CAGGGGCAATTTTGTTTCTCAGG - Intergenic
1142474141 17:179969-179991 TGGTGGCACATTTGATGCTTGGG + Intronic
1144019411 17:11226816-11226838 TAGTGGCTTTTTTCCTTCTTCGG - Intergenic
1146096356 17:29933555-29933577 TAGGAGGACTTTTGTCTCTTTGG - Intronic
1148496505 17:48056168-48056190 TAGTGGCTCTTTTTTTTTGTGGG + Intronic
1148882200 17:50737711-50737733 TAGTGGCAATTTTGCATCCTGGG - Intronic
1149133894 17:53341566-53341588 TAGTGACAATTATGTGTCTTGGG - Intergenic
1150088692 17:62299908-62299930 TTGCTGTACTTTTGTTTCTTTGG - Intergenic
1151537203 17:74745689-74745711 TAGTGGCCCTTTTGCTTTCTAGG + Exonic
1151845030 17:76647596-76647618 TGGTGGAACTGTTGTTTCCTTGG + Intergenic
1152018458 17:77767763-77767785 CATCGGCACTTTTGGTTCTTGGG - Intergenic
1153692784 18:7609922-7609944 TTGTGGCAATTTTGTTTCCTTGG + Intronic
1155558808 18:27052543-27052565 TAGTGTCACAGTTGTCTCTTTGG - Intronic
1155641114 18:28016280-28016302 TATTGCTTCTTTTGTTTCTTAGG + Intronic
1156019604 18:32584892-32584914 TAGTGCCCCTTTTGTTTTTTGGG - Intergenic
1160589118 18:79931461-79931483 TTGGGGCACTGTTGTTTGTTAGG - Intronic
1162360465 19:10217009-10217031 TAATTGCACATTTGTGTCTTGGG + Intronic
1162407907 19:10486633-10486655 TTGAGGCACTTTTGTTTCTTGGG - Exonic
1165104191 19:33459241-33459263 TTGGGGCCCTTTTGTTTCTGGGG - Intronic
926965132 2:18401651-18401673 TAGTGGCTGCTTTGTTTCTGGGG - Intergenic
927417698 2:22896095-22896117 TCCTGGCACTTTTCTTGCTTGGG - Intergenic
928902195 2:36331596-36331618 TAGTATCAGTTTTGTTCCTTAGG - Intergenic
929912254 2:46100193-46100215 CAGGGGCACTCTTGTTACTTGGG - Intronic
930239400 2:48920771-48920793 TTTTTGCCCTTTTGTTTCTTTGG - Intergenic
932273113 2:70428391-70428413 TACTGGTACTTTCATTTCTTAGG - Intergenic
932284903 2:70524037-70524059 TTGAGACACTTTTGTTTCTAAGG + Intronic
932567651 2:72919780-72919802 TTGTAGCATTTTTGTTTTTTCGG - Intronic
937845241 2:126572472-126572494 TAGTTGCACACTTCTTTCTTGGG + Intergenic
938577356 2:132617218-132617240 TATTTGCACTTTTTTTTTTTTGG + Intronic
938754233 2:134365075-134365097 AAGTGGCACCTTTGTGTCCTGGG + Intronic
939240101 2:139547063-139547085 TAATTGTACTTTTGTTTCATAGG + Intergenic
939730665 2:145781062-145781084 CATTGGGACTTTTGTCTCTTTGG + Intergenic
939834043 2:147106381-147106403 CATTGGCACTTCTGATTCTTGGG - Intergenic
939961692 2:148571049-148571071 CAGTGTCACTTTTGCCTCTTGGG + Intergenic
940421735 2:153486909-153486931 TGGTGCAACTCTTGTTTCTTAGG - Intergenic
940795386 2:158071805-158071827 TAGTGTCACTTTTAGTTATTTGG - Intronic
941152245 2:161929073-161929095 TACTGGCCCTTTTATTTCTGAGG + Intronic
941765806 2:169295105-169295127 CAGTGGTACTTTAGTTTCCTGGG - Intronic
943419427 2:187652078-187652100 TAATGCCAATTATGTTTCTTTGG + Intergenic
946506809 2:220310194-220310216 TATTGTTACTTTTTTTTCTTGGG + Intergenic
946770696 2:223085679-223085701 TAGTGTCTCTTCTTTTTCTTAGG + Intronic
948742212 2:240055489-240055511 TGGTGTCACTTTTGATTCTCAGG - Intergenic
1169563844 20:6830887-6830909 TACTGGAATTTTTGTTTCGTTGG + Intergenic
1169734540 20:8823683-8823705 TAGTGGCATCTTTGTTTCTATGG + Intronic
1170226784 20:13999253-13999275 TAGAGTCACTTTTCTTTCATAGG + Intronic
1173134855 20:40430406-40430428 GAGTTTCGCTTTTGTTTCTTAGG - Intergenic
1173974317 20:47175607-47175629 AAGTGGCACTTTTGTTATCTGGG + Intronic
1174912604 20:54623123-54623145 TAGTGGCAGTTTTATTTCCCAGG + Intronic
1177055125 21:16292274-16292296 TAGGGGCACTTTTGTATTTTGGG + Intergenic
1177920373 21:27144294-27144316 TAGTGGCACCTTTCTCTCTCTGG - Intergenic
1178775406 21:35545391-35545413 TAATGGCACCTTTGTTGCCTTGG + Intronic
1181570537 22:23765854-23765876 TAATTGCACATTTGTGTCTTGGG + Exonic
1182163197 22:28144466-28144488 AACTGGCAGTTTTCTTTCTTTGG + Intronic
1183246859 22:36700527-36700549 TAGTGGCAATTTGCTTTCCTTGG - Intronic
1183957002 22:41386715-41386737 GAGTTTCACTTTTGTTGCTTCGG - Intronic
952106038 3:30070320-30070342 TTGTGGTATTTTTGTTTGTTTGG - Intergenic
952418712 3:33112707-33112729 TCATGGCACTTTTTTCTCTTAGG - Intergenic
954484129 3:50830703-50830725 TAGTGGTACTGTTGGCTCTTTGG + Intronic
956055797 3:65297382-65297404 TGGTAGCATTTTTTTTTCTTTGG - Intergenic
956645893 3:71455772-71455794 TAATAGCTCTTTTCTTTCTTAGG - Intronic
957793457 3:84969713-84969735 TAGTATTATTTTTGTTTCTTGGG - Intronic
960840289 3:121951297-121951319 TTGTGGCTCTCTTGTTTCTCAGG - Intergenic
965239307 3:166174195-166174217 TAGTAGCATTTTGGTTTCCTAGG + Intergenic
965503682 3:169486728-169486750 TAGTTTCACATTTGTTTCTGGGG - Intronic
965926089 3:173982231-173982253 CAGAAGCACTTTTGTTTCTGAGG + Intronic
966656896 3:182368917-182368939 TATTGGCCCTTTTGGTTCTTTGG + Intergenic
966998844 3:185312319-185312341 CAGTTCCAATTTTGTTTCTTTGG + Intronic
969906827 4:10405024-10405046 TAGTGGCTCCTTTGGTTCTTAGG + Intergenic
970848242 4:20569513-20569535 TTCTAACACTTTTGTTTCTTTGG + Intronic
971460435 4:26890190-26890212 TAGGCCCACTTTTTTTTCTTCGG + Intronic
972262440 4:37423505-37423527 CATTGGCACTCCTGTTTCTTTGG - Intronic
975031276 4:69620654-69620676 TTGTGGCTCTTTTTTTTTTTTGG - Intronic
976370696 4:84285607-84285629 TATTGGCAATTTTGTGTATTGGG - Intergenic
976791320 4:88881181-88881203 TAGTTGTAGTTTTGTTTATTGGG - Intronic
977131688 4:93247583-93247605 CATTGGCTCTCTTGTTTCTTAGG + Intronic
978167769 4:105629456-105629478 TAAGGGCACTTTTATTTCTGTGG + Intronic
979371611 4:119894963-119894985 CAGTGACACTCTTGTTTCTTTGG + Intergenic
980603204 4:135053137-135053159 TGGTGGCAATTTTGTTATTTGGG + Intergenic
981016753 4:139981617-139981639 TAATGTCACTTTTGTGTTTTAGG + Intronic
982631849 4:157840074-157840096 GAGTGGCACTTTTATTCCTGTGG + Intergenic
982805448 4:159756986-159757008 TATTGGAAGTTTTGTATCTTTGG + Intergenic
982963701 4:161875235-161875257 CTCTGGCACTTTTGTTACTTAGG - Intronic
984699059 4:182807006-182807028 GAGTGGCATTTTTATTTCTGAGG + Intergenic
986819655 5:11451400-11451422 CAGTTGCACATTTGTGTCTTTGG - Intronic
989241866 5:39211187-39211209 TAGTGGCTTATTTGGTTCTTAGG + Intronic
990016725 5:51072806-51072828 TAGTGGTGCTTTATTTTCTTTGG + Intergenic
990872574 5:60448996-60449018 AAGTTCCACTATTGTTTCTTTGG + Intronic
993641506 5:90410958-90410980 AAGTTCCACTTTTGTTTTTTAGG - Intergenic
994829899 5:104767215-104767237 TTATGGCACCTTTGTTTTTTTGG + Intergenic
995281755 5:110343665-110343687 TATTGGCAATTTTGCTGCTTTGG - Intronic
995340848 5:111057504-111057526 AAGAGGCACTTTGGTTTTTTGGG + Intergenic
995668790 5:114575842-114575864 TAGTTGCAGTTTTTTCTCTTTGG - Intergenic
996225292 5:120985724-120985746 TAGTGGCACTTGTTTGTTTTAGG + Intergenic
997123761 5:131204080-131204102 TATAGGGCCTTTTGTTTCTTTGG + Exonic
998586384 5:143431766-143431788 TAGGGGCACTTTTGTAGCCTTGG + Intronic
999965030 5:156800174-156800196 AACTGTCTCTTTTGTTTCTTGGG + Intergenic
1000802967 5:165751681-165751703 TAGAGGGTTTTTTGTTTCTTGGG + Intergenic
1001129330 5:169050683-169050705 TAATAGCACTTTTTTTTTTTTGG + Intronic
1002005941 5:176235181-176235203 TAATGTCACTTATGTTTCCTTGG - Intergenic
1002220438 5:177675451-177675473 TAATGTCACTTATGTTTCCTTGG + Intergenic
1002935138 6:1665344-1665366 CATTGTCACTTTTGATTCTTAGG - Intronic
1003518370 6:6836454-6836476 CAGTGGTATTTTAGTTTCTTTGG - Intergenic
1005325772 6:24699122-24699144 TAGTTACATTTTTGTTGCTTAGG - Intronic
1006696743 6:35937315-35937337 TATTGGCCATTTTCTTTCTTAGG - Intergenic
1007803891 6:44422608-44422630 AAGTGGCACTTCTGTTAATTGGG + Intronic
1008482509 6:52000888-52000910 TTGTGCCTCTTTTGTTTCTCAGG - Intronic
1010046141 6:71446183-71446205 CAGTGTAACTTTTGCTTCTTTGG + Intergenic
1011392716 6:86872142-86872164 TTGAGGCTCTTTTGTTTTTTTGG - Intergenic
1011889454 6:92138865-92138887 TAGTTTCACTTTTGTTGCCTAGG - Intergenic
1011977592 6:93324370-93324392 TAGTGGCACTGATGTTTATGAGG - Intronic
1012434717 6:99203439-99203461 AAGAGGCACTTTTGCTTTTTGGG + Intergenic
1013020469 6:106211016-106211038 TAGTGTCAGTTTTGTTGTTTTGG + Intronic
1013193477 6:107824590-107824612 TAATGACACTTCTGCTTCTTTGG + Intergenic
1015346651 6:132168171-132168193 TAATGGCACTTTTGTTTTAGTGG - Intergenic
1020538573 7:9432014-9432036 TATTGCCACTTTTGGTTTTTGGG + Intergenic
1020686300 7:11299496-11299518 TAGTGTTACATTTGTTTCATTGG + Intergenic
1021283964 7:18756286-18756308 TAGTGTCATCTTTGTTTCTCAGG - Intronic
1021329708 7:19320843-19320865 TAGTCACACCTTTGTTTCTGAGG + Intergenic
1022877251 7:34547086-34547108 TAGTGATCCTTTTGTGTCTTTGG - Intergenic
1023255945 7:38311944-38311966 TATTTGCACGTTTGTGTCTTGGG - Intergenic
1023388630 7:39685706-39685728 TACTGGAACATCTGTTTCTTGGG - Intronic
1023452998 7:40308197-40308219 TAGTTTCACATTTGTATCTTTGG - Intronic
1027475305 7:78622944-78622966 TACTGGCACTTTAGTTTGCTGGG - Intronic
1030133852 7:106227266-106227288 TAATTTCACTTTTGTTTTTTAGG - Intergenic
1030485192 7:110156632-110156654 TACTGTCTCTTTGGTTTCTTTGG - Intergenic
1030778458 7:113566606-113566628 TAGTTACAATTATGTTTCTTCGG + Intergenic
1033772430 7:144567032-144567054 TAGTTTCACTTTTGTTTTTCAGG - Intronic
1035087796 7:156276060-156276082 TTCTGGTCCTTTTGTTTCTTAGG - Intergenic
1036745939 8:11409687-11409709 AAGTGGCTCTTTTGGTCCTTGGG - Intronic
1036750133 8:11438509-11438531 TGCTAGCACTTTTGCTTCTTTGG + Exonic
1036948697 8:13120596-13120618 TAGTGGCATTTTTGTTCAGTGGG - Intronic
1039951856 8:42179265-42179287 TAGTGGCACTGCTGATGCTTCGG + Intronic
1040997571 8:53417612-53417634 TAATGGAACTTCAGTTTCTTTGG - Intergenic
1042112337 8:65393977-65393999 CAGTGGAACTTCTGATTCTTGGG - Intergenic
1043134797 8:76507692-76507714 TAGTTTCACTTTTTTATCTTAGG + Intergenic
1044069863 8:87744840-87744862 TAATAGCACTTTTGTTACTTTGG + Intergenic
1045131223 8:99155677-99155699 TAATGGCACTTTTGGTTTTTTGG + Intronic
1046057561 8:109096987-109097009 AAGTTGCACTTTTGTTATTTTGG - Intronic
1047264963 8:123298067-123298089 TAGTGGGACTTTTTTTTGTGGGG + Intergenic
1047356894 8:124130225-124130247 TAGTGTCACGTTTCTTTTTTGGG - Intergenic
1051279896 9:15431669-15431691 GAGTGACACTTTTGACTCTTAGG + Intronic
1051927111 9:22341977-22341999 CACTGTCACTATTGTTTCTTGGG - Intergenic
1051961318 9:22767094-22767116 TGGTGGGATTTTTGTTTGTTTGG + Intergenic
1052348209 9:27431230-27431252 TTGTTTAACTTTTGTTTCTTTGG - Intronic
1052502358 9:29307776-29307798 TACTGTCACTTTTGTTCCATAGG - Intergenic
1053084656 9:35208516-35208538 TGGTGGCACTTCTGCTTCTGGGG + Intronic
1055666540 9:78558530-78558552 GAGTAGCCCTTTTGTTTTTTGGG - Intergenic
1056037574 9:82623395-82623417 TATTGGCAGGGTTGTTTCTTCGG - Intergenic
1056046777 9:82726555-82726577 TAGCCACTCTTTTGTTTCTTTGG - Intergenic
1056613806 9:88143950-88143972 TAGTTCTATTTTTGTTTCTTTGG + Intergenic
1058025069 9:100133851-100133873 AAGAGGCACTTATTTTTCTTAGG - Intronic
1060582430 9:124762043-124762065 TAGTAGTACTTTTTTTACTTTGG - Intronic
1061172838 9:128971215-128971237 TACTGGCATTTTTGTTGCTTTGG - Intronic
1061604822 9:131700922-131700944 TAGTCTTACTTTTGCTTCTTGGG + Intronic
1061941998 9:133888866-133888888 AAGTGTCACTTTTGTTTCTGAGG - Intronic
1185736388 X:2500180-2500202 AAGTGGCAACTTTGTTTCCTTGG - Intronic
1185947761 X:4396866-4396888 TCTTGGTACTTTTGTTTCATGGG + Intergenic
1188286914 X:28338337-28338359 TAGTGGCACTTTTGTTCTGAGGG - Intergenic
1189903285 X:45730688-45730710 TAGAGCCACTTTTGTTCCTCTGG - Intergenic
1190947968 X:55114311-55114333 ATGTGGCACTTTTGTATTTTTGG + Intronic
1192134009 X:68580159-68580181 TAACCTCACTTTTGTTTCTTAGG + Intergenic
1194146167 X:90266880-90266902 TAGTTGTACTTTGGGTTCTTGGG + Intergenic
1195438110 X:104868609-104868631 AAGCAGCACTTATGTTTCTTTGG - Intronic
1195821061 X:108945938-108945960 TAGAGAGACTTTTGTTTCTTTGG - Intergenic
1196217829 X:113074705-113074727 TAGTGGTAATGTTTTTTCTTCGG + Intergenic
1197650969 X:129063303-129063325 TTGAGGCACTGTTGTTTCTTGGG - Intergenic
1197802347 X:130364606-130364628 TAATGTCACTTGTGTTTCGTAGG + Exonic
1198082815 X:133255051-133255073 TAGTGGCACTATTGCCTTTTTGG - Intergenic
1198383641 X:136107014-136107036 CTGTGGTACTTTTGTTACTTAGG - Intergenic
1199413213 X:147549685-147549707 TAGTGGAGCTGTTGTTACTTTGG + Intergenic
1200491911 Y:3836148-3836170 TAGTTGTACTTTGGGTTCTTGGG + Intergenic
1201507547 Y:14719979-14720001 AAGTTTCAATTTTGTTTCTTTGG + Intronic