ID: 1081626229

View in Genome Browser
Species Human (GRCh38)
Location 11:44656910-44656932
Sequence GTGGCTCCATACCTCTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081626229_1081626231 -6 Left 1081626229 11:44656910-44656932 CCACTAAAGAGGTATGGAGCCAC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1081626231 11:44656927-44656949 AGCCACAGTCAATAAGATGTGGG No data
1081626229_1081626233 -2 Left 1081626229 11:44656910-44656932 CCACTAAAGAGGTATGGAGCCAC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1081626233 11:44656931-44656953 ACAGTCAATAAGATGTGGGCCGG No data
1081626229_1081626230 -7 Left 1081626229 11:44656910-44656932 CCACTAAAGAGGTATGGAGCCAC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1081626230 11:44656926-44656948 GAGCCACAGTCAATAAGATGTGG No data
1081626229_1081626234 12 Left 1081626229 11:44656910-44656932 CCACTAAAGAGGTATGGAGCCAC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1081626234 11:44656945-44656967 GTGGGCCGGAATAGAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081626229 Original CRISPR GTGGCTCCATACCTCTTTAG TGG (reversed) Intergenic
906687250 1:47770629-47770651 GTGGCTCCAGGGCTCTTCAGTGG + Intronic
908749410 1:67405564-67405586 GTGGCTCCATACTTTGCTAGTGG + Intergenic
914199262 1:145470313-145470335 GTAGCTCCATACATTTTTGGGGG - Intergenic
914478376 1:148043449-148043471 GTAGCTCCATACATTTTTGGGGG - Intergenic
915559712 1:156679517-156679539 ATGCCACCCTACCTCTTTAGGGG - Intergenic
920397764 1:205659364-205659386 GTGGCCCCATCCCTGTTTATGGG - Exonic
920762071 1:208794038-208794060 ATGGGTCCATAACTCTTTAGTGG + Intergenic
921930643 1:220751697-220751719 GGGGCTCTATAGCTCTTTTGGGG + Intronic
1063581041 10:7307551-7307573 CTGGCTCCATACATCAGTAGGGG + Intronic
1064776381 10:18782429-18782451 GTAGTTTCAAACCTCTTTAGTGG + Intergenic
1076520968 10:131081085-131081107 GTGGCTCCATACTGCTTTTCTGG + Intergenic
1081626229 11:44656910-44656932 GTGGCTCCATACCTCTTTAGTGG - Intergenic
1088546304 11:110962824-110962846 GTGGTTCTATACAGCTTTAGGGG - Intergenic
1089879176 11:121757095-121757117 GATGCCCCATCCCTCTTTAGTGG - Intergenic
1095685295 12:45026245-45026267 CTGACTCCATTCCACTTTAGAGG - Intronic
1109462211 13:62676210-62676232 GTGGTTCCATACCTCTGAAATGG + Intergenic
1111565902 13:90015845-90015867 GTGGCTCCATATATATTTTGAGG + Intergenic
1112041835 13:95554484-95554506 GTGGTACCATACCTGTTTGGGGG + Intronic
1112311020 13:98317648-98317670 GTGGCTCCATACCACTTAGGTGG + Intronic
1116050337 14:39795190-39795212 GTGGCTCCCTTACTCCTTAGAGG + Intergenic
1119670543 14:76514932-76514954 TTGGCTCCTTGCCTCTTCAGTGG - Intergenic
1122818400 14:104326812-104326834 GTGGCTCCAAACCTCTTTGCTGG + Intergenic
1122866191 14:104605017-104605039 GTGGCTCCCGAAGTCTTTAGCGG - Intronic
1124589439 15:31040415-31040437 GTGGCTCCATAAGTCCTTGGTGG - Intronic
1126554932 15:49976073-49976095 TTGGCGCCATACCTCTTTTGGGG - Intronic
1130690342 15:86076833-86076855 TTGGCTGCATAACTCTATAGGGG + Intergenic
1138060672 16:53886925-53886947 GTGGCTCCACGTTTCTTTAGCGG + Intronic
1142803097 17:2357181-2357203 ATGGCTCCAGACCTTTGTAGGGG + Intronic
1142931569 17:3289427-3289449 GTGGCTCCATTCCACCCTAGTGG + Intergenic
1149543940 17:57489302-57489324 GCTGCTACATGCCTCTTTAGGGG - Intronic
1153780049 18:8486444-8486466 GTGGCTCAATAATTCTTCAGGGG + Intergenic
1155263099 18:24064150-24064172 CTGGCTCCAAAACTCATTAGTGG - Exonic
1158610177 18:58932623-58932645 AAGGCTCCATACCTATTAAGTGG - Intronic
1167104849 19:47424146-47424168 GTGGCCCAGGACCTCTTTAGGGG - Intergenic
926121015 2:10241159-10241181 GTGGCAACAAACCTCTCTAGAGG + Intergenic
944280102 2:197885876-197885898 TTGGCTAAAAACCTCTTTAGAGG + Intronic
945486085 2:210397638-210397660 GTGGATCCATATCTTTTAAGGGG + Intergenic
1169222683 20:3834959-3834981 GTATATCCATACCTCTTTAGGGG + Intergenic
1170727806 20:18945606-18945628 ATGGCTCCACATGTCTTTAGTGG + Intergenic
1173569949 20:44069658-44069680 GGGGCTCTATGCCACTTTAGGGG - Intergenic
1184142336 22:42585206-42585228 GTGGCTCCAGGCCTCACTAGTGG - Exonic
954890162 3:53920131-53920153 GTGGCACCATGCCTCTTAAGTGG + Intergenic
959292681 3:104494505-104494527 GTGGCTCCATTTCTCCTCAGAGG + Intergenic
961459618 3:127042102-127042124 GTGGCTCCATCCCTGTTTGCTGG + Intergenic
964388538 3:156174762-156174784 GTGGCTCCATGCCTCCTGATGGG - Intronic
975587718 4:75967265-75967287 GTGGCAGCTTACCTCTTTGGTGG + Exonic
988225037 5:28402824-28402846 GAGGTTTCACACCTCTTTAGTGG - Intergenic
991084961 5:62640199-62640221 CTGGAACCAGACCTCTTTAGGGG + Intergenic
993767435 5:91878664-91878686 GTGTCTCCCAACATCTTTAGTGG + Intergenic
997783858 5:136687800-136687822 GTCACTCTGTACCTCTTTAGTGG - Intergenic
999095361 5:148973233-148973255 GTGGCTCGATATTTCCTTAGTGG + Intronic
1003005467 6:2377021-2377043 GTGGCTTCTTACTTCTTTATTGG - Intergenic
1005097745 6:22136476-22136498 GTCTCTCCAAACCTCTTTACTGG + Intergenic
1007684009 6:43654169-43654191 GTGGCTCCGTGACTCTCTAGGGG + Intronic
1009425897 6:63513366-63513388 GTGGCTCCATAACACTTTGTTGG - Intergenic
1012684805 6:102232646-102232668 GTGGTTCCATATCTTTTAAGTGG + Intergenic
1020532044 7:9350391-9350413 GTGGCTGCTTAGCTATTTAGGGG - Intergenic
1022253856 7:28635997-28636019 GTGGCTCAATAACTATTTATTGG - Intronic
1023479933 7:40623109-40623131 GTGGTTCCATATGTCTTTACTGG - Intronic
1031778188 7:125927733-125927755 GTGGCTCCATACAGCTGTAGAGG + Intergenic
1032989982 7:137383014-137383036 GTGCCTCCATGCCTCTGTATTGG + Intronic
1045027451 8:98101348-98101370 GTGGCTCCATCCGTCTCTTGGGG - Intergenic
1051191417 9:14517105-14517127 GTGGCTCCCAATCTATTTAGGGG - Intergenic
1055029390 9:71758264-71758286 TTGGCCCCACACCTGTTTAGAGG - Intronic
1059282446 9:113146625-113146647 GTCTCTCGATACCTCTTAAGTGG - Intergenic
1186865391 X:13715555-13715577 GTGGCGCCATTCTTCTTGAGTGG + Intronic
1190787412 X:53665048-53665070 GTGGCCACATACCTATTAAGTGG + Intronic
1191087080 X:56580479-56580501 GTCACTCCATGCCTCTTAAGTGG + Intergenic
1194543278 X:95201747-95201769 GTGGTTCCATATCTTTTAAGTGG + Intergenic
1197311565 X:124911702-124911724 CTGGCTCCATCCCACTTTACTGG - Intronic
1197333675 X:125185038-125185060 GTTGCTCAATACCTGTTTATTGG + Intergenic