ID: 1081626232

View in Genome Browser
Species Human (GRCh38)
Location 11:44656929-44656951
Sequence GGCCCACATCTTATTGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081626232_1081626234 -7 Left 1081626232 11:44656929-44656951 CCACAGTCAATAAGATGTGGGCC No data
Right 1081626234 11:44656945-44656967 GTGGGCCGGAATAGAACTGCTGG No data
1081626232_1081626236 20 Left 1081626232 11:44656929-44656951 CCACAGTCAATAAGATGTGGGCC No data
Right 1081626236 11:44656972-44656994 TTTATGAAGACATGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081626232 Original CRISPR GGCCCACATCTTATTGACTG TGG (reversed) Intergenic
No off target data available for this crispr