ID: 1081626234

View in Genome Browser
Species Human (GRCh38)
Location 11:44656945-44656967
Sequence GTGGGCCGGAATAGAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081626229_1081626234 12 Left 1081626229 11:44656910-44656932 CCACTAAAGAGGTATGGAGCCAC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1081626234 11:44656945-44656967 GTGGGCCGGAATAGAACTGCTGG No data
1081626226_1081626234 29 Left 1081626226 11:44656893-44656915 CCAAAGAAACAAAAGTGCCACTA 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1081626234 11:44656945-44656967 GTGGGCCGGAATAGAACTGCTGG No data
1081626232_1081626234 -7 Left 1081626232 11:44656929-44656951 CCACAGTCAATAAGATGTGGGCC No data
Right 1081626234 11:44656945-44656967 GTGGGCCGGAATAGAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081626234 Original CRISPR GTGGGCCGGAATAGAACTGC TGG Intergenic
No off target data available for this crispr