ID: 1081626439

View in Genome Browser
Species Human (GRCh38)
Location 11:44658804-44658826
Sequence AGGGCTGAGCAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081626434_1081626439 -8 Left 1081626434 11:44658789-44658811 CCAGATGAAAGACAGAGGGCTGA No data
Right 1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081626439 Original CRISPR AGGGCTGAGCAGAGGGAGGG AGG Intergenic
No off target data available for this crispr