ID: 1081628297

View in Genome Browser
Species Human (GRCh38)
Location 11:44669042-44669064
Sequence ACTAGGGACCAGCAGTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081628287_1081628297 18 Left 1081628287 11:44669001-44669023 CCAGGCGACATGTCCGCACCACC No data
Right 1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG No data
1081628286_1081628297 19 Left 1081628286 11:44669000-44669022 CCCAGGCGACATGTCCGCACCAC No data
Right 1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG No data
1081628291_1081628297 -3 Left 1081628291 11:44669022-44669044 CCCAGTGCCACTCAGTGCGGACT No data
Right 1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG No data
1081628292_1081628297 -4 Left 1081628292 11:44669023-44669045 CCAGTGCCACTCAGTGCGGACTA No data
Right 1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG No data
1081628288_1081628297 5 Left 1081628288 11:44669014-44669036 CCGCACCACCCAGTGCCACTCAG No data
Right 1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG No data
1081628285_1081628297 23 Left 1081628285 11:44668996-44669018 CCTTCCCAGGCGACATGTCCGCA No data
Right 1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG No data
1081628295_1081628297 -10 Left 1081628295 11:44669029-44669051 CCACTCAGTGCGGACTAGGGACC No data
Right 1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG No data
1081628289_1081628297 0 Left 1081628289 11:44669019-44669041 CCACCCAGTGCCACTCAGTGCGG No data
Right 1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081628297 Original CRISPR ACTAGGGACCAGCAGTGCCT GGG Intergenic
No off target data available for this crispr