ID: 1081628717

View in Genome Browser
Species Human (GRCh38)
Location 11:44672445-44672467
Sequence GGGGCAGATGCCACTTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081628706_1081628717 22 Left 1081628706 11:44672400-44672422 CCCCAATGTTGGGGGTGGAGCCT No data
Right 1081628717 11:44672445-44672467 GGGGCAGATGCCACTTTGCTTGG No data
1081628712_1081628717 2 Left 1081628712 11:44672420-44672442 CCTGGTGGAAGCTGTGTGGATCA No data
Right 1081628717 11:44672445-44672467 GGGGCAGATGCCACTTTGCTTGG No data
1081628708_1081628717 20 Left 1081628708 11:44672402-44672424 CCAATGTTGGGGGTGGAGCCTGG No data
Right 1081628717 11:44672445-44672467 GGGGCAGATGCCACTTTGCTTGG No data
1081628707_1081628717 21 Left 1081628707 11:44672401-44672423 CCCAATGTTGGGGGTGGAGCCTG No data
Right 1081628717 11:44672445-44672467 GGGGCAGATGCCACTTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081628717 Original CRISPR GGGGCAGATGCCACTTTGCT TGG Intergenic
No off target data available for this crispr