ID: 1081629343

View in Genome Browser
Species Human (GRCh38)
Location 11:44678082-44678104
Sequence AAGCCAATGCTGCTACCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081629337_1081629343 -4 Left 1081629337 11:44678063-44678085 CCCACAGGGCCCCCAGAAGAAGC No data
Right 1081629343 11:44678082-44678104 AAGCCAATGCTGCTACCAACAGG No data
1081629338_1081629343 -5 Left 1081629338 11:44678064-44678086 CCACAGGGCCCCCAGAAGAAGCC No data
Right 1081629343 11:44678082-44678104 AAGCCAATGCTGCTACCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081629343 Original CRISPR AAGCCAATGCTGCTACCAAC AGG Intergenic
No off target data available for this crispr