ID: 1081634367

View in Genome Browser
Species Human (GRCh38)
Location 11:44711163-44711185
Sequence CAGGGTAGAGAGGAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081634357_1081634367 3 Left 1081634357 11:44711137-44711159 CCCTTAGAGCCTTATGGTGGGTT No data
Right 1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG No data
1081634353_1081634367 23 Left 1081634353 11:44711117-44711139 CCTTTTGAGAACTAGGTGGACCC No data
Right 1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG No data
1081634361_1081634367 -6 Left 1081634361 11:44711146-44711168 CCTTATGGTGGGTTCTCCAGGGT No data
Right 1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG No data
1081634358_1081634367 2 Left 1081634358 11:44711138-44711160 CCTTAGAGCCTTATGGTGGGTTC No data
Right 1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081634367 Original CRISPR CAGGGTAGAGAGGAGGAGGG AGG Intergenic
No off target data available for this crispr