ID: 1081639782

View in Genome Browser
Species Human (GRCh38)
Location 11:44744920-44744942
Sequence CTGCTGAGCCTGGGTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081639782_1081639790 22 Left 1081639782 11:44744920-44744942 CCTGTTTTACCCAGGCTCAGCAG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1081639790 11:44744965-44744987 TTGACGTCTGTCATGGTTGGAGG 0: 1
1: 0
2: 1
3: 6
4: 131
1081639782_1081639792 26 Left 1081639782 11:44744920-44744942 CCTGTTTTACCCAGGCTCAGCAG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1081639792 11:44744969-44744991 CGTCTGTCATGGTTGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 307
1081639782_1081639788 15 Left 1081639782 11:44744920-44744942 CCTGTTTTACCCAGGCTCAGCAG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1081639788 11:44744958-44744980 TCAATTATTGACGTCTGTCATGG 0: 1
1: 0
2: 8
3: 34
4: 139
1081639782_1081639791 25 Left 1081639782 11:44744920-44744942 CCTGTTTTACCCAGGCTCAGCAG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1081639791 11:44744968-44744990 ACGTCTGTCATGGTTGGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 209
1081639782_1081639789 19 Left 1081639782 11:44744920-44744942 CCTGTTTTACCCAGGCTCAGCAG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1081639789 11:44744962-44744984 TTATTGACGTCTGTCATGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 65
1081639782_1081639793 29 Left 1081639782 11:44744920-44744942 CCTGTTTTACCCAGGCTCAGCAG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1081639793 11:44744972-44744994 CTGTCATGGTTGGAGGAGGGTGG 0: 1
1: 0
2: 4
3: 40
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081639782 Original CRISPR CTGCTGAGCCTGGGTAAAAC AGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900349938 1:2229622-2229644 CTGCTGAGCCAGGATTACACGGG + Exonic
900773409 1:4563588-4563610 CCACTGAGCCTGGCTAAAATGGG + Intergenic
900953974 1:5875538-5875560 CTGCTGAGTCTCGGTCACACCGG + Intronic
901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG + Intronic
901622288 1:10598218-10598240 CTGCTGAGAGTGGGAAAAGCAGG - Intronic
901725040 1:11235084-11235106 CTGCTATGACTGGGGAAAACAGG - Intronic
904238455 1:29128755-29128777 AGGCAGAGCCTGGGTAAAGCTGG + Intergenic
909478424 1:76108663-76108685 CTTCTGAGCCTGGGTATGAAGGG + Intronic
911179105 1:94845443-94845465 CTGCTGAGCCTGGGAACTGCAGG + Exonic
911754979 1:101543705-101543727 CTGCTGCTGCTGGGTAAAAACGG + Intergenic
918231897 1:182541711-182541733 CTGGTGAGCATGTGTAAAAAGGG - Intronic
918313751 1:183305558-183305580 CTGTTTTTCCTGGGTAAAACAGG + Intronic
919747152 1:201016081-201016103 CTGCTGAGCCTTAGTAACATGGG - Intronic
919764084 1:201115216-201115238 CTGCTGGGCCCGGGTACAGCAGG + Exonic
919933721 1:202237702-202237724 CTCCTTTGCCTGGGTATAACAGG + Intronic
920571982 1:207024395-207024417 CTGCTGAGCCTGAATACCACTGG + Intronic
922226355 1:223649341-223649363 CTGCTGAGCCTGTGAGAAACAGG + Intronic
1063351380 10:5359189-5359211 CTGAGGAGCCAGGGAAAAACAGG + Intergenic
1066194836 10:33089039-33089061 CTCCTGAGCCTAGCTGAAACTGG - Intergenic
1066733412 10:38452493-38452515 CAGCTGTGCCGGGGGAAAACTGG - Intergenic
1068818285 10:61343321-61343343 CAGCTGGACCTGGGTAATACTGG - Intergenic
1069892339 10:71659909-71659931 CAGCTGAGTCAGGGTAAACCTGG - Intronic
1073100318 10:101002964-101002986 CTTGTGGGCCTGGGTAGAACGGG + Intronic
1075068012 10:119302738-119302760 CTGCAGAGCCTGGGAACCACAGG + Intronic
1075480811 10:122780233-122780255 CTCCTGAGCCTGGGCCAAAGTGG - Intergenic
1077958234 11:7044392-7044414 CTGCTGAACCTGGTAAACACAGG + Intronic
1081536730 11:44002134-44002156 CTCCTGAGCCAAGGTGAAACAGG + Intergenic
1081639782 11:44744920-44744942 CTGCTGAGCCTGGGTAAAACAGG - Intronic
1082812070 11:57484453-57484475 CAGCTGAGCCTGGGTGAAGAAGG + Intergenic
1084278267 11:68067918-68067940 CTGCTGAGCCTGGCAAACAAGGG + Intronic
1084996723 11:72987055-72987077 CTGAAGAGCCTGGGAAACACTGG - Intronic
1085024963 11:73231012-73231034 GTCCTGACCCTGGGTAAGACGGG + Intronic
1087175926 11:95095378-95095400 GTGCTGAGACTGGATAAGACTGG + Intronic
1088112711 11:106280296-106280318 GTGCTGAGCCTCTGTAAAGCAGG - Intergenic
1091526534 12:1307092-1307114 CAGCTGAGCTTTAGTAAAACAGG - Intronic
1095482548 12:42651175-42651197 GTGCTAAGCCTTGGAAAAACAGG + Intergenic
1097815089 12:64064900-64064922 CTGCTTGGCCTGGCTACAACTGG - Intronic
1102181474 12:110915812-110915834 CAGCTCAGCCTGGGAGAAACTGG + Intronic
1104039318 12:125119363-125119385 CTGCAGAACCTGTGTGAAACAGG - Intronic
1104379122 12:128291576-128291598 CAACTGAGCCTTGGGAAAACAGG - Intronic
1104797005 12:131526956-131526978 CCGCAGAGCCTGGGCAGAACAGG - Intergenic
1105247669 13:18667267-18667289 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1106753701 13:32799664-32799686 CTCCTAGGCCTGGGTAGAACAGG - Intergenic
1107914654 13:45137125-45137147 TTGCTTAGGCTGGGTATAACTGG + Intronic
1109274705 13:60290705-60290727 CTGCTGAACCTGGGCCCAACAGG - Intergenic
1110050938 13:70898190-70898212 CTCCTGGGCCTTGGGAAAACAGG - Intergenic
1112046165 13:95600388-95600410 GTGATGAGCCAGGGTAAAAATGG + Intronic
1113031915 13:106002696-106002718 CTGCTGTGCCTGCGTAATTCTGG + Intergenic
1115197008 14:30812304-30812326 CTGCTGCGCATGTGTAAAAAAGG + Intergenic
1117911785 14:60643725-60643747 CGGCTCAGTCTGGGTAAAAGGGG - Exonic
1119463194 14:74829321-74829343 CTTCTGAGCCTGGGAAGAAGAGG + Exonic
1122776736 14:104120216-104120238 CTTCTGAGTCTGGGGCAAACTGG + Intergenic
1123776311 15:23584132-23584154 GTGCTGAACCTGGGGAAAATGGG + Intronic
1123992462 15:25693819-25693841 CTGTTGAGCCTGGGTTACAGTGG - Intronic
1125234544 15:37497748-37497770 CTGCTTAGCCAAGCTAAAACTGG + Intergenic
1125349328 15:38751470-38751492 CTCCTGAGACTTGGGAAAACTGG + Intergenic
1126333013 15:47554328-47554350 CTGCTTAGCCTGGAGAAGACAGG + Intronic
1126385774 15:48091845-48091867 TTGCTTAGTCTGGGTAGAACTGG + Intergenic
1128791844 15:70439903-70439925 CTGGGGAGCCTGGGGAACACTGG - Intergenic
1134275171 16:12769592-12769614 CTGCTGAGGCTGATTAAAAGTGG - Intronic
1142254016 16:89005437-89005459 CTGCTGAGGCTGGGTCAGCCAGG + Intergenic
1142626472 17:1195470-1195492 TTGCTGAGCCTGGGTCAGGCAGG - Intronic
1142803870 17:2361593-2361615 CATCTGAGCCTGGGAAAGACGGG - Intronic
1143599143 17:7932538-7932560 GAGCTGACCCTGGGTAGAACGGG + Exonic
1146016859 17:29240647-29240669 CTGGTCAGCCTGGGTAAGCCAGG + Intergenic
1152287617 17:79421924-79421946 CTGCTGAGCCTGTGGAACATGGG - Intronic
1152784050 17:82238921-82238943 AGGCTGAGCCTGAGAAAAACGGG + Exonic
1155204189 18:23543398-23543420 CTGCTGAGCCTGGAGAAAGAAGG - Intronic
1156656261 18:39291060-39291082 CTTCTGAGCCTGGGTCTAAAAGG + Intergenic
1157124932 18:44947450-44947472 CTTTTGGACCTGGGTAAAACAGG - Intronic
1158198875 18:54918228-54918250 CTGCTGAACTTGGTTTAAACAGG - Intronic
1158237960 18:55340377-55340399 TTGCAGAGCCTGGGAAACACAGG + Intronic
1159035174 18:63270299-63270321 CTGTTCATCCTGGGAAAAACTGG + Intronic
1161378465 19:3951865-3951887 TTGCTCAGCCTGGGGAAACCGGG + Intergenic
1163441616 19:17324844-17324866 GGGCTGAGCCTGGGTCCAACGGG - Exonic
1165042867 19:33081284-33081306 CGGCGGAGCCTGTGGAAAACAGG + Intronic
925754234 2:7118679-7118701 CTGGTGAGCCTGGAGCAAACAGG + Intergenic
926310129 2:11669205-11669227 CTGCAGAGCCTGTGAAAATCCGG - Intronic
927095427 2:19744637-19744659 CAGGTCAGCCTGGGGAAAACAGG + Intergenic
928640784 2:33296628-33296650 CAGCTGAGCCTGGGAAAGATTGG + Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
939991986 2:148884516-148884538 TTGCTGATCATGGTTAAAACTGG - Intronic
942236682 2:173915614-173915636 CTGCTCAGGGTGGGAAAAACAGG + Intronic
942473774 2:176292436-176292458 CTCCTGAGCATGTGTAAAAGAGG - Intronic
943264460 2:185709854-185709876 CTGCTGTGCCAAGGTAAAAAGGG + Intergenic
944917740 2:204378221-204378243 ACGCTGAGTCTGGGGAAAACAGG + Intergenic
946464334 2:219897939-219897961 CTCCTGAGGTTGGGAAAAACTGG - Intergenic
947874214 2:233457796-233457818 CTGCAGGGCCTGGGTCACACTGG + Intronic
948456908 2:238108811-238108833 CTGCTGAGACTGGGTGACCCGGG - Intronic
1171214447 20:23342098-23342120 CTGCTGATGCTGGGCAAACCAGG + Intergenic
1174360272 20:50024470-50024492 CTGATGACCCTGGCTAAACCAGG + Intergenic
1174777460 20:53358252-53358274 TTACTGAGCCTGGGTAAACTGGG + Intronic
1176454884 21:6899323-6899345 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1176833057 21:13764371-13764393 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1178420996 21:32443054-32443076 CTGCTGAGCCTGGAGGAAAAGGG - Intronic
1180083368 21:45496823-45496845 TTGCTGAGCCTGGGAAAATGGGG - Intronic
1181493978 22:23277672-23277694 CTGCTGAGCCTGGGCAAGTCTGG + Intronic
1181703107 22:24631979-24632001 CTGCTGAGCCTGGTCAACAGAGG + Intergenic
1183719315 22:39553112-39553134 GTGCTGACTGTGGGTAAAACAGG - Intergenic
949689657 3:6621168-6621190 CTGCTGAGCATTGGGAATACAGG + Intergenic
950500884 3:13362882-13362904 CTGCTGAGCCTGTCTGAAGCAGG + Intronic
950612158 3:14133608-14133630 CTGCTGCGCCTGGGCTAATCTGG + Intronic
953190254 3:40679339-40679361 CTGCTCAGCCTGGGTAATGCAGG - Intergenic
953333306 3:42072411-42072433 CTGCAGAGCCTGCGTACAGCTGG - Intronic
953495068 3:43378764-43378786 CTATAGAGCCTGGGTAAAGCTGG + Intronic
959575701 3:107930970-107930992 ATGCTGTGAGTGGGTAAAACAGG + Intergenic
966248891 3:177839627-177839649 GTGCTGTGCCTGGGTATAACAGG + Intergenic
966443217 3:179970453-179970475 CTCCTGCTCCTGGGTAAAACAGG - Intronic
968873433 4:3253133-3253155 CTGCTGAGGCTGGGCAGGACAGG + Intronic
971860672 4:32100413-32100435 CTGCTGAGGCATGGAAAAACAGG + Intergenic
977764719 4:100783451-100783473 CTGCTGAGCCTGTGTGCATCAGG + Intronic
978775649 4:112504139-112504161 CTTTTAAGCCTGGGTACAACAGG + Intergenic
984439171 4:179745149-179745171 TTGCTGAGTCTGGGTAAAGAAGG - Intergenic
985123250 4:186664889-186664911 TTGCTGAGCATAGGTAAAATTGG - Intronic
986244838 5:5997901-5997923 CTGCTGGACCTGGATAAAGCAGG - Intergenic
987057698 5:14210361-14210383 GTGCGGAGCCTGGGGAAAGCTGG - Intronic
992263432 5:74993206-74993228 CTGATGACCCTGGGCAAGACAGG - Intergenic
1003995491 6:11536948-11536970 CTGCCGAGCCTGGAGTAAACAGG + Intergenic
1004357443 6:14942333-14942355 CTTCTGAGCCTCAGTAAAAGGGG + Intergenic
1005994999 6:30925635-30925657 CTGCTGCGCCTGGGGGTAACAGG - Exonic
1006400968 6:33817131-33817153 CCGCTCAGCCTGGGGGAAACTGG + Intergenic
1006731586 6:36240099-36240121 CTGCAGAGCCAGGGTCAACCTGG + Intergenic
1010419902 6:75661357-75661379 CTGCTTAGCCTAGGTAAAGGAGG + Intronic
1011191258 6:84730642-84730664 CTTCTGTGCCAGGGTACAACAGG - Intronic
1017116622 6:150983513-150983535 CTGCAGAGCCTGGGACAAAGGGG - Intronic
1019224618 6:170499971-170499993 CTGCTGGGCCCGGCTAACACAGG + Intergenic
1019694182 7:2435691-2435713 CACCTGAGCCTGGGAAACACAGG - Intergenic
1021171074 7:17398587-17398609 TTGCTTTTCCTGGGTAAAACAGG + Intergenic
1021355243 7:19646322-19646344 CTCCTGAGCCTGTGAAAATCAGG - Intergenic
1024118740 7:46216521-46216543 CAGCTGAGCCTGGGTATAACAGG - Intergenic
1024710899 7:52013276-52013298 CTGCTGAGCCTGGGAAATAGTGG + Intergenic
1028010359 7:85635151-85635173 CTGGTTAGTCTGGGTAAAACTGG + Intergenic
1029413648 7:100430248-100430270 CTGCTGCGCCTGGGGACCACTGG - Exonic
1030216666 7:107050383-107050405 GTGCTGTGTCTGGGTAGAACAGG + Intronic
1033227560 7:139573389-139573411 CTGCTGAGCCTGGGGAGGAGAGG + Exonic
1034156510 7:148959954-148959976 CAGCTGAGCCTGTGGAAGACAGG + Intergenic
1041320162 8:56604331-56604353 CTGCTGATCCTGGTGCAAACAGG - Intergenic
1041621178 8:59971139-59971161 CTTCTGAGACTGGGTAATAAGGG - Intergenic
1043715098 8:83473182-83473204 CTGATGAGGCTTGGAAAAACTGG + Intergenic
1045239259 8:100384602-100384624 CTGCAGAGCCTGGGGAAGCCTGG - Intronic
1048999534 8:139816013-139816035 TTCCCGAGCCTGGATAAAACTGG + Intronic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1054810877 9:69432939-69432961 CAGCTGGGGCTGGGTAAAAAGGG + Intronic
1055734687 9:79314286-79314308 CTCCTGAGGCTGGGGAATACAGG + Intergenic
1056617025 9:88177563-88177585 CTCATGATTCTGGGTAAAACTGG + Intergenic
1061951417 9:133938405-133938427 CTGGTGAGCCTGGGTACAGAGGG - Intronic
1062527290 9:136983113-136983135 CTGCTGAGCCTGGATCAAAGAGG - Exonic
1186853729 X:13605634-13605656 CTTCTGAACCTGGCTTAAACCGG - Intronic
1187879964 X:23837741-23837763 CTCCTGAGCCTGGGAGAAAGAGG - Intronic
1188806045 X:34591154-34591176 ATGCTGAGCCTGGGGTAAACAGG - Intergenic
1192181064 X:68916132-68916154 CTGCTGAGCCAGGGCAGGACTGG - Intergenic
1192237499 X:69305380-69305402 GTGCTGAGCCTGGATCAAGCAGG + Intergenic
1193334100 X:80267102-80267124 CTTCTGAGCCTGGGTATATGAGG - Intergenic
1195241857 X:102960238-102960260 CTCCTGAGCCTGAGGGAAACAGG + Intergenic
1197831432 X:130647180-130647202 CTGCTAAGCCAGGGTACAATGGG + Intronic
1197986325 X:132269737-132269759 CTGCTGAGAGTGGATAAAATAGG - Intergenic
1199320729 X:146435480-146435502 CTGCTGATCCTAGGAAAAAATGG + Intergenic
1199974489 X:152884966-152884988 CTGCTCAGCTTGGGAAAAAGGGG - Intergenic