ID: 1081641274

View in Genome Browser
Species Human (GRCh38)
Location 11:44755975-44755997
Sequence ATGGAGAGAGAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8740
Summary {0: 1, 1: 4, 2: 61, 3: 926, 4: 7748}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081641274 Original CRISPR ATGGAGAGAGAGATGGAGGA GGG Intronic
Too many off-targets to display for this crispr