ID: 1081651778

View in Genome Browser
Species Human (GRCh38)
Location 11:44828705-44828727
Sequence GCTGGGCTACAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081651778_1081651790 28 Left 1081651778 11:44828705-44828727 CCTTCCCCCTTCTGTAGCCCAGC 0: 1
1: 0
2: 1
3: 25
4: 354
Right 1081651790 11:44828756-44828778 CATGGCCCGAGGCCACGACCAGG 0: 1
1: 0
2: 1
3: 8
4: 98
1081651778_1081651791 29 Left 1081651778 11:44828705-44828727 CCTTCCCCCTTCTGTAGCCCAGC 0: 1
1: 0
2: 1
3: 25
4: 354
Right 1081651791 11:44828757-44828779 ATGGCCCGAGGCCACGACCAGGG 0: 1
1: 0
2: 1
3: 6
4: 68
1081651778_1081651786 10 Left 1081651778 11:44828705-44828727 CCTTCCCCCTTCTGTAGCCCAGC 0: 1
1: 0
2: 1
3: 25
4: 354
Right 1081651786 11:44828738-44828760 GGAGAGCCTCAGTCCATTCATGG 0: 1
1: 0
2: 0
3: 14
4: 104
1081651778_1081651788 17 Left 1081651778 11:44828705-44828727 CCTTCCCCCTTCTGTAGCCCAGC 0: 1
1: 0
2: 1
3: 25
4: 354
Right 1081651788 11:44828745-44828767 CTCAGTCCATTCATGGCCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081651778 Original CRISPR GCTGGGCTACAGAAGGGGGA AGG (reversed) Intronic
900582225 1:3414893-3414915 TCTGGGCTCCAGGAGGGAGAAGG + Intronic
900727234 1:4224773-4224795 GGTAGGCTTCAGAAGGGGAAGGG - Intergenic
900961399 1:5923370-5923392 GCTGGGAAACAGAAGAGGGAAGG + Intronic
901871376 1:12140896-12140918 GCTGGGCAAAAGATGGGGGCCGG - Intronic
902219171 1:14953993-14954015 GATGGGCTGCAGAAGGGCAAGGG + Intronic
902764804 1:18607059-18607081 GCTGGCCTGCAGGAAGGGGACGG + Intergenic
902770435 1:18642724-18642746 GCTGGGGTGGAGCAGGGGGAGGG + Intronic
903875736 1:26472171-26472193 GCTGGGTTGCATAAGGTGGAAGG + Intergenic
903950045 1:26991436-26991458 GCTGGGGCTCAGTAGGGGGAAGG - Intergenic
904247429 1:29197740-29197762 GCAGGGATACAGAAGAGAGAGGG - Intronic
904430754 1:30462581-30462603 ACTGGGCTGCGGGAGGGGGAAGG + Intergenic
905283155 1:36861847-36861869 GCTGGGTGACAGAGGAGGGAGGG + Intronic
905452909 1:38068501-38068523 GCTGCTCTACTGAGGGGGGAGGG - Intergenic
906974779 1:50558396-50558418 GACGGGTTACAGAATGGGGAAGG + Intronic
907255681 1:53177023-53177045 GCTGGCACACAGAAGGGAGAGGG - Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
910891826 1:92026851-92026873 GCTGGGCATCAGAGGGGGGACGG + Intergenic
912575303 1:110665495-110665517 GATGGGCTAGAGAGGGGAGAAGG + Intergenic
912753938 1:112308814-112308836 GCTGGGGTTCATAAGGGGAAGGG + Intergenic
913322918 1:117601949-117601971 GTAGGGATCCAGAAGGGGGATGG - Intergenic
914196034 1:145448560-145448582 GCTGGGGCACGGAAGGGGAAAGG + Intergenic
915341154 1:155177463-155177485 CCTGGGCTGCAGGAGGGGGCAGG + Intronic
915733231 1:158068683-158068705 GCTGGGCCATCGAAGGGCGAAGG - Intronic
916563705 1:165955117-165955139 CCTGGGCTCCAGAAGTGGGAGGG - Intergenic
917629659 1:176879438-176879460 GGTGGGCTACAAAAGGTGGCTGG - Intronic
917685436 1:177411253-177411275 GCTATGCCACAGAAGGGGGAGGG + Intergenic
918548978 1:185718031-185718053 GCTGTGCTAGAGAAGGGAGATGG + Intergenic
920340038 1:205269896-205269918 GCTGGGCTGCAGGAGGGGGTGGG - Intronic
920403469 1:205692088-205692110 GCTGGGGGACAGAGGGGGAAAGG - Intergenic
921135576 1:212256495-212256517 GGTGGGGTAAAGAAGAGGGATGG - Intergenic
921799527 1:219386092-219386114 ACTGGGCAACAGAGGGGAGACGG + Intergenic
921808146 1:219479412-219479434 GCTGGGCAAGAGGAGGAGGATGG - Intergenic
921814696 1:219550211-219550233 GCTGGGCAACATTAGGGGTAGGG - Intergenic
921950352 1:220923060-220923082 GCGGGGCTTAAGGAGGGGGAGGG + Intergenic
924802522 1:247337779-247337801 GCTGGGTCACAGTCGGGGGAAGG + Intergenic
924876538 1:248111169-248111191 GCGGAGCTACAGCAGCGGGAAGG - Intergenic
1064982045 10:21174460-21174482 GCTGGGGAAGAGAAGAGGGAGGG - Intergenic
1065523487 10:26594221-26594243 TCTTGGCGACAGCAGGGGGAGGG - Intergenic
1067775371 10:49161122-49161144 GCCGGTCTACAGAAGGGGACAGG - Intronic
1067775953 10:49165023-49165045 GCTGTGCTACAGAAGTGAAAAGG + Intronic
1067841102 10:49679949-49679971 GCTGGGCTAAAAGAGTGGGAAGG + Intronic
1069589687 10:69634141-69634163 TCTGGGCCACAGAGGGAGGAGGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069826881 10:71260100-71260122 GCTGGGCCACAGGAAGGAGAGGG - Intronic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1070978737 10:80627529-80627551 GCTGGGCTCCAGAACTGGGTGGG + Intronic
1071149789 10:82620488-82620510 GCTGGGCTTCAGAGGAGAGATGG - Intronic
1071478993 10:86048875-86048897 ACTGAGCTTCAGAAAGGGGAAGG - Intronic
1072316746 10:94210920-94210942 ACTGGGCTACAGAAGGGAAAGGG - Intronic
1072482793 10:95826062-95826084 ACTGGGCTACACAATAGGGAAGG + Intronic
1072617417 10:97059112-97059134 GCTGGGCTTCGGGCGGGGGACGG + Intronic
1074164739 10:110865307-110865329 GCAGGGCTGAGGAAGGGGGATGG - Intergenic
1074873164 10:117593786-117593808 GCTGGTATATAGAAGGTGGATGG + Intergenic
1075078082 10:119364568-119364590 GCTGGGGTACAGCAGGAGGGAGG - Intronic
1075086798 10:119419114-119419136 GGTGGGCTGGAGAAGGGAGAGGG - Intronic
1075101587 10:119510081-119510103 GTTGGGCAAGAGAAGGCGGATGG - Intronic
1075669661 10:124255735-124255757 GCTGGGCTAATGGAGGGTGATGG + Intergenic
1076021852 10:127080416-127080438 CCTGGGGTACAGGAGGGGGTCGG - Intronic
1076057419 10:127387017-127387039 GCAGTGCTACAGAATGGGCAGGG + Intronic
1076125403 10:127970171-127970193 GCTGGGAGACACAAGAGGGAGGG + Intronic
1076131123 10:128014708-128014730 GCTGGGGTTGAGACGGGGGATGG - Intronic
1076736740 10:132462397-132462419 GCTGGGCTCCAGGAGGGAAAGGG + Intergenic
1078535164 11:12167354-12167376 CCTGGGCTACACACAGGGGAGGG - Intronic
1078895283 11:15592020-15592042 GCTGGGCTTCACATGGAGGAAGG + Intergenic
1079314708 11:19397869-19397891 GCTGGGCTGCAGTAGGGGAGGGG + Intronic
1079833499 11:25301116-25301138 TCTGGGCAACAGAAGGGGTTTGG - Intergenic
1080714824 11:34790188-34790210 GCTTGCCTACAGAAGGAGGGAGG - Intergenic
1080716589 11:34808138-34808160 ACTGTGATACAGAAGAGGGAGGG + Intergenic
1081590258 11:44417809-44417831 GCAGGGCTACAGAAGCAGGTGGG - Intergenic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1083660779 11:64250975-64250997 CCTGGGCTAGGGACGGGGGAGGG + Intergenic
1083773968 11:64884140-64884162 GCTGGGCCACAGGACGGGGAGGG - Intronic
1084985722 11:72869372-72869394 GCAGGGCAAGAGAAGGGGAAAGG + Intronic
1085161812 11:74354661-74354683 GCAGGGCCACACAAGGTGGATGG + Intronic
1085785494 11:79444766-79444788 GCTGGGCTAGAGAGGGGGAGAGG + Intergenic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1089335739 11:117722367-117722389 GCTGGGAAAGATAAGGGGGAGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090217788 11:124984799-124984821 GCTGGGCCAAAGGAGGAGGAAGG - Intronic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090635365 11:128687566-128687588 GCGGGGCTTCAGGATGGGGAGGG - Intronic
1091577231 12:1749144-1749166 GCAGGGCTACGTATGGGGGAAGG + Intronic
1091828735 12:3534398-3534420 GCTGGACATCTGAAGGGGGAAGG - Intronic
1092908609 12:13125067-13125089 GCTGGGCTAAGGTCGGGGGAAGG - Intronic
1093881266 12:24406598-24406620 ACTGGGCCCCAGATGGGGGAGGG + Intergenic
1094760614 12:33528323-33528345 AGTGGACTACAGAAGGGGAATGG - Intergenic
1095373382 12:41496660-41496682 ACTGGGCTACAGAATGGAGCTGG + Intronic
1095968459 12:47884838-47884860 GCTGGGTGACAGAAAGTGGATGG - Intronic
1096197414 12:49657587-49657609 TCTGTGATACAGAAGTGGGATGG - Intronic
1096276965 12:50217694-50217716 GCAGGTCTACAGTGGGGGGAAGG + Intronic
1096836936 12:54357164-54357186 CTTGGGCTACAGAGAGGGGAAGG - Intergenic
1097178889 12:57159708-57159730 TCTGGGCTACAGAGGGGTGCAGG - Intronic
1097262675 12:57728264-57728286 GCTGGGGTGCAGAAGGGTGGGGG - Intronic
1098071650 12:66682230-66682252 GCTGTGCTTCAGAGGGGAGAAGG - Intronic
1098847684 12:75558432-75558454 CTTGGGCTAGAGAAGGGTGATGG - Intergenic
1099637797 12:85237312-85237334 TCTGGACTACAGCAGAGGGAAGG + Intronic
1100613148 12:96208863-96208885 GCTGGGCCAGGGAAAGGGGAAGG + Intronic
1101564896 12:105895860-105895882 GCTGTGATCCAGTAGGGGGAAGG - Intergenic
1102606492 12:114071622-114071644 GTTGGGATACAGAAGCTGGATGG - Intergenic
1103612650 12:122133553-122133575 GCTGGGAGACAGCAGGGGCATGG - Exonic
1104610062 12:130220344-130220366 GCTGGGCTGGAGAGGAGGGAAGG + Intergenic
1104707291 12:130956559-130956581 GCTGGGCTCCAGTAGGGGAGAGG + Intronic
1104980101 12:132569860-132569882 CCTGGGCCACAGGAGGGGCAGGG + Intronic
1105203327 13:18197413-18197435 TCTGGGAGACAGAAGGGGAATGG - Intergenic
1105874811 13:24541923-24541945 GTCGGGCTTCAGGAGGGGGAAGG + Intergenic
1106164781 13:27234268-27234290 GCTGGGTAACAGGAGAGGGAGGG - Intergenic
1107840573 13:44452552-44452574 GCTGGGCTACTCATGGGGAAGGG + Intronic
1108437143 13:50411593-50411615 GCTGGGCCAGGGAAGCGGGAGGG + Intronic
1108914273 13:55588607-55588629 GCTGGGGGAGAGAAGGAGGATGG + Intergenic
1112199586 13:97261907-97261929 ACTGGCCTCAAGAAGGGGGAAGG - Intronic
1113654722 13:112061020-112061042 TCTGGGCAGCAGAAGAGGGAGGG + Intergenic
1113680358 13:112239142-112239164 GCTGGGCTCCTGAGGGGGGTGGG + Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1114547715 14:23514471-23514493 GCTGGGCTCTAGAATGGGAAGGG + Intergenic
1115302447 14:31899681-31899703 GGTGGGATATAGAAGGGAGAAGG + Intergenic
1115488758 14:33938577-33938599 ACTGGGGTAGAGATGGGGGAGGG - Intronic
1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG + Intergenic
1117830034 14:59741160-59741182 GCTTGGCTGGAGGAGGGGGAAGG - Intronic
1118849635 14:69573805-69573827 GCTGAGCGCCAGAACGGGGATGG + Intronic
1119691792 14:76678787-76678809 GCAGGGCTAGAGTAGGGGGCAGG + Intergenic
1121475501 14:94197692-94197714 GCTGGGTTACAAAAGGGACATGG - Intronic
1121699337 14:95940526-95940548 GCTGGGCTACTTATGGGTGAGGG + Intergenic
1122427959 14:101622698-101622720 GCTGGGGTCCAGAATGGGTAGGG - Intergenic
1123205282 14:106706740-106706762 GCTGGGCTAGAGAAGCTGGGGGG - Intergenic
1123210326 14:106754007-106754029 GCTGGGCTAGAGAAGCTGGGGGG - Intergenic
1202849691 14_GL000225v1_random:9026-9048 GCTGGGCTGGAGCACGGGGATGG - Intergenic
1202852581 14_GL000225v1_random:30708-30730 GCTGGGCTGGAGCAGGGGGACGG - Intergenic
1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG + Intergenic
1202864263 14_GL000225v1_random:104913-104935 GCTGGGCTGGAGCACGGGGACGG + Intergenic
1202868228 14_GL000225v1_random:136411-136433 GCTGGGCTGGAGCACGGGGACGG + Intergenic
1202921974 14_KI270723v1_random:35308-35330 GCTGGGCTGGAGCACGGGGACGG - Intergenic
1202922954 14_KI270724v1_random:2305-2327 GCTGGGCTGGAGCACGGGGACGG + Intergenic
1123907957 15:24938877-24938899 GCTGGGCTACAGACTGGGATTGG + Intronic
1125732412 15:41900620-41900642 GGTGGGCTGCAGAACGGGGTGGG - Exonic
1126098313 15:45104612-45104634 GCTGGGGTAGGGAAGGGGAAGGG + Intronic
1127968062 15:63938673-63938695 TCTGGGGTACAGAATGGGCAGGG + Intronic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128109687 15:65068381-65068403 GCTGAGCTAAAGAAAGGGCAAGG - Intronic
1128355359 15:66922718-66922740 GCTGGGCTGGAGGAGGGAGAGGG + Intergenic
1129058171 15:72837088-72837110 GCTGGGCCACAGCATTGGGAGGG - Intergenic
1129383829 15:75184679-75184701 TCTGGGCTAAAGAGGAGGGAGGG + Intergenic
1129543017 15:76366730-76366752 CTTGGGCTATAGAAGTGGGAGGG - Intronic
1129718707 15:77866247-77866269 GCAGGCCTGCAGAAGGGGGTGGG - Intergenic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1130948323 15:88566268-88566290 GGTGGGCTACAGCAGGAGAAAGG + Intergenic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131502530 15:92982830-92982852 GATGGGGTAGAGAAGGGGGAAGG + Intronic
1132650437 16:1019115-1019137 GCTGGGCTCCAAAAGGAGGAGGG - Intergenic
1132672121 16:1106295-1106317 GCTGGGACACGGAAGGAGGAGGG - Intergenic
1133028173 16:2997620-2997642 GTTGGGGTACAGAAGGGGGCTGG - Intergenic
1133328687 16:4958064-4958086 GCGGGGCCAGTGAAGGGGGAGGG + Intronic
1133601340 16:7343007-7343029 GCTGGGTTGCAGGACGGGGAGGG + Intronic
1133932672 16:10244957-10244979 GCTGGGCTGCAGACTGGTGAAGG + Intergenic
1134452555 16:14372504-14372526 CCTGGGATACAGGTGGGGGAGGG - Intergenic
1136060801 16:27725021-27725043 GCTGGGCCAGAGGAGAGGGATGG + Intronic
1136223418 16:28843578-28843600 GCTAGCCAACAGAAGGGGCATGG - Intronic
1136550683 16:30980855-30980877 GCTGGGCTGCAGGAGGGGCTGGG + Intronic
1136573506 16:31110131-31110153 GCTGGGCCAGAGCAGGGTGAGGG + Intronic
1136910672 16:34141847-34141869 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1137072048 16:35912184-35912206 AGTGGGCTTCAGAAGTGGGATGG - Intergenic
1137582275 16:49640729-49640751 GCTGGGCTTCAGAGGTGGGTTGG - Intronic
1137670551 16:50275892-50275914 GCTGGGCTACCCAAGGGTGGTGG - Intronic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139668605 16:68475676-68475698 GCTGTGCAAAAGAAGGAGGAGGG - Intergenic
1139939085 16:70591830-70591852 TCAGGGCAACAGCAGGGGGAAGG - Intronic
1141044465 16:80703897-80703919 GCTGGGCAAGAGAAGGGAGGTGG - Intronic
1141684687 16:85563575-85563597 GCTGAGCTCCAGAATGGGGTGGG - Intergenic
1142378945 16:89721191-89721213 GGCGGGCTGCAGAAAGGGGAGGG - Intronic
1143164202 17:4889837-4889859 GGTGGGGGAGAGAAGGGGGAAGG - Intronic
1143231503 17:5359421-5359443 GCTGTGATACTGAAGAGGGAAGG - Intronic
1143334162 17:6159842-6159864 GCTGAGCTGCCGAAGTGGGAGGG - Intergenic
1144814743 17:18026098-18026120 TCTGGGCTAGAGAAGAGGGGTGG + Intronic
1147374954 17:40017821-40017843 GCTGGACTCAAGAAGGAGGAAGG - Intergenic
1147580627 17:41625430-41625452 CTTGGGGTACAGAAGGGTGAGGG - Intergenic
1147868381 17:43569644-43569666 GCTGGGTGACAGAGGGTGGAAGG - Intronic
1148865354 17:50625525-50625547 GCAGGGACACAGAAGGGGAAGGG + Intronic
1149367504 17:55960581-55960603 GCTGGGAGACAGAAGCAGGAGGG + Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1150682874 17:67297268-67297290 GCAGGCCTGCAGAAGAGGGAGGG - Intergenic
1150721897 17:67620504-67620526 GCAGGGATAGAGAAGGGTGAGGG - Intronic
1151311507 17:73295423-73295445 GCTGGGAAAGAGAAGAGGGAAGG + Intronic
1151422056 17:74005164-74005186 GCTGGGCTTCAGAGGGTGGGTGG - Intergenic
1151444094 17:74152089-74152111 GCAGGGCTACAGATGGAGCAAGG - Intergenic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152596914 17:81242239-81242261 GCTGGGCACAAGAAGGAGGAAGG - Intergenic
1152818794 17:82425090-82425112 GCTGGGCTAGAGAAGGCCGGAGG + Intronic
1152818827 17:82425215-82425237 GCTGGGCTAGAGAAGGCCGGAGG + Intronic
1152818847 17:82425322-82425344 GCTGGGCTAGAGAAGGCTGGAGG + Intronic
1154485527 18:14868720-14868742 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1156524323 18:37752301-37752323 GATGGGCTAGAGAGGGGGTATGG - Intergenic
1157923088 18:51733787-51733809 GCTGGCCTGGAGTAGGGGGAAGG + Intergenic
1158181055 18:54715254-54715276 GCTGGACTGCAGAAGGGGAGTGG - Intergenic
1158265591 18:55657661-55657683 GCTGGGCCACTGGAGGTGGAAGG + Intronic
1158631608 18:59119982-59120004 GCTGAGCTACAGTAGGGTGAGGG + Intergenic
1158683698 18:59593515-59593537 TCTGTGCTACTGAAGGAGGATGG - Intronic
1159549604 18:69880561-69880583 GCTGTGCAAGAGAATGGGGAGGG + Intronic
1160782990 19:886061-886083 GCTGGGCTTCAGCAGGGACACGG + Exonic
1161028510 19:2047517-2047539 GCTTGTCCACAGAATGGGGACGG + Intronic
1161238420 19:3209044-3209066 CCTGGGCCACGGAAGGGAGACGG - Exonic
1161310552 19:3591683-3591705 ACTGGGCTGCAGGATGGGGATGG - Exonic
1162369832 19:10271872-10271894 GCTGGGCTGGAGCTGGGGGAGGG - Intronic
1163653573 19:18532637-18532659 GCTGGGGCACAGAATGGGCAGGG - Intronic
1164189323 19:22900583-22900605 GCTGGGCTCCAGAGAGAGGAAGG + Intergenic
1164702819 19:30297904-30297926 CCTGGGCGACAGAGGGGGGGGGG - Intronic
1164880613 19:31729653-31729675 ACTGAGTTACAAAAGGGGGATGG + Intergenic
1165403030 19:35613797-35613819 GCTGGGCTAGAGCAGGGGAGGGG + Intronic
1165814353 19:38632514-38632536 GCTGGGCTCCCCAAGGGGAAGGG + Intronic
1166827056 19:45616269-45616291 GCGGGGCTACACAAAGGGGCGGG + Intronic
1166937522 19:46343335-46343357 GCTGGGCTAGGGAAAGGGGAGGG + Exonic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167454514 19:49591413-49591435 GCTGAGCCAAGGAAGGGGGAAGG - Intergenic
1167817101 19:51892673-51892695 GATGGTCTACAGAATGGAGAAGG - Intronic
1168644506 19:58051481-58051503 GCTGGGCTAGAGACGGAGGAGGG - Intronic
925149006 2:1601734-1601756 GCTGGGCTGCAGAGGGGTCAAGG + Intergenic
925746909 2:7051296-7051318 GCTGAGCTCCAGTAGGGTGAGGG + Intronic
926695957 2:15770381-15770403 GCTGGGGTCCAGAGGTGGGAGGG - Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
932157411 2:69430799-69430821 CCCTGGCTACAGAAGGGGTAAGG + Intronic
932567092 2:72917210-72917232 GCTGAGCTACACACCGGGGAGGG + Intronic
932887569 2:75561018-75561040 GCTGGCTTGCAGAAGGGGGCGGG - Intronic
933466464 2:82658187-82658209 GATGGGCAGCCGAAGGGGGATGG - Intergenic
934946049 2:98542814-98542836 ACAGGGTAACAGAAGGGGGAAGG - Intronic
935355099 2:102190503-102190525 GCTGGGACACAGAAAGGGGCTGG - Intronic
935735768 2:106105647-106105669 GCTGGGCTCCAGCAGGGCAAAGG - Intronic
938583638 2:132669602-132669624 GCTGGGCTTGAGAGGAGGGAGGG - Intronic
938814033 2:134881517-134881539 GTAGAGGTACAGAAGGGGGATGG - Intronic
941188238 2:162344085-162344107 GCTGGCCTGCGGAAGGGGGCGGG + Exonic
944103626 2:196055543-196055565 ACTGGGCTACACAATGGGAAGGG + Intronic
944572999 2:201063308-201063330 GCAAGGCCACAGAAGGTGGATGG + Intronic
945193851 2:207219350-207219372 GCTGGGTTAGGGAAGGGGTACGG - Intergenic
946654495 2:221931369-221931391 GCTGAGCTACAGACCAGGGAGGG + Intergenic
947704783 2:232265411-232265433 GCTGGACTAGAGCTGGGGGAGGG - Intronic
947859673 2:233349563-233349585 GAAGGGCTGGAGAAGGGGGATGG + Intergenic
948453661 2:238093960-238093982 GGTGGGCACCAGGAGGGGGAGGG + Intronic
948879745 2:240850661-240850683 GCTGGGCTACAGAAGGCAAGAGG + Intergenic
1168905898 20:1403533-1403555 GATGGGCAGCAGGAGGGGGAGGG + Intergenic
1171194378 20:23186114-23186136 GCAGGGCCACAGAAGGAGAAGGG - Intergenic
1171346763 20:24471058-24471080 GCTGGGCTGTAGGAGGGAGACGG - Intronic
1171780237 20:29410938-29410960 GCTGGGCTGGAGCAGGGGGACGG + Intergenic
1171824201 20:29879202-29879224 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1171906127 20:30900555-30900577 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1172245821 20:33444114-33444136 GCTGGGCTGCATATGGCGGAGGG + Intergenic
1173183652 20:40822659-40822681 GCTGGGCTATACAATTGGGAAGG + Intergenic
1174447136 20:50597833-50597855 GCTGGGCTTCTGCTGGGGGACGG - Intronic
1175877889 20:62238875-62238897 GCCGGGCGACCGCAGGGGGAAGG - Intronic
1176369284 21:6052738-6052760 GCTGGGCAAGAGCAGGGGGGCGG + Intergenic
1176795808 21:13370756-13370778 GGTGGGCTGAAGAAGTGGGAAGG + Intergenic
1177728268 21:24995288-24995310 GCTGGGGCACAGAAGGAGGGGGG + Intergenic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1179754235 21:43485803-43485825 GCTGGGCAAGAGCAGGGGGGCGG - Intergenic
1179881957 21:44296668-44296690 ACTGGGCTCCCGCAGGGGGAGGG - Intronic
1180275541 22:10635879-10635901 GCTGGACCACAGAAGGGTCAGGG + Intergenic
1180289489 22:10783986-10784008 GGTGGGCTGAAGAAGTGGGAAGG + Intergenic
1180305411 22:11068813-11068835 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1180339552 22:11606674-11606696 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1182363547 22:29762777-29762799 GACGGGATACAGGAGGGGGATGG - Intronic
1183580524 22:38723303-38723325 GCTGGGCGACAGCAGGTGCATGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1184422324 22:44389353-44389375 CCTGGGGTACAGAAGGGAGGTGG + Intergenic
1184767122 22:46577621-46577643 GCTGGGCCACTGGAGGGGGACGG + Intronic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
949940312 3:9149631-9149653 GCTGGCCTGCAGGAGGGTGAGGG + Intronic
950267403 3:11584831-11584853 TCTGGGCTTCAGGAGGCGGAAGG + Intronic
950610433 3:14123669-14123691 TCTGCGCCAGAGAAGGGGGATGG - Intronic
950725405 3:14913904-14913926 GCAGGGCTAGAGGAGGAGGAGGG - Intronic
954390211 3:50264740-50264762 GCCGGGCTCCAGAGGAGGGAGGG + Intergenic
955207321 3:56908092-56908114 GCTGGGCAACAAAAGGAGAAAGG + Intronic
956344434 3:68262436-68262458 GGTGGACTACTAAAGGGGGAAGG - Intronic
957084859 3:75669571-75669593 GCTGGGCTGGAGCACGGGGACGG - Intergenic
959896521 3:111612900-111612922 GGTGGGCTACAGATGCAGGAGGG - Intronic
960036123 3:113104805-113104827 GCTGGGCTACAGATGGAGAGGGG + Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962080512 3:132134533-132134555 TCTGCACTACTGAAGGGGGAGGG + Intronic
963641458 3:147865573-147865595 GAAGGGCTACTGATGGGGGAGGG + Intergenic
964606876 3:158569896-158569918 ACTTGGCTAAAAAAGGGGGATGG + Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
966533313 3:181004436-181004458 GCTGGGCTCCACAGGGGGGTGGG + Intergenic
968232912 3:197014997-197015019 GCTGAGATTCAGAAAGGGGAAGG + Intronic
970048539 4:11884080-11884102 GCTAGGCTTCAGGAGGGGCATGG - Intergenic
973259526 4:48148077-48148099 GCTGGGCTGGTGAAGGGGGATGG + Intronic
976621708 4:87134936-87134958 GCAGAGCTTCAGAAGGGGCAAGG - Intronic
977521729 4:98093691-98093713 GCATGGCTACAGTTGGGGGATGG - Intronic
981871486 4:149492297-149492319 GATGGGTTACAGAAGTGGAAAGG + Intergenic
981907793 4:149942640-149942662 GCTGGGCTCCTAAAGGGGGCTGG + Intergenic
982086507 4:151841618-151841640 GCTGGGCTGCAGTGGGGAGAGGG - Intergenic
985957079 5:3273865-3273887 GGTGGGCTAAAAATGGGGGAGGG - Intergenic
986296483 5:6443563-6443585 GCTGGGCCTCTGTAGGGGGAAGG - Intergenic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
987040364 5:14056391-14056413 ACTGGACTACAGAAGTGGGGAGG + Intergenic
987122230 5:14778116-14778138 GCTGGGCAACAGGAAGGTGAGGG + Intronic
987180634 5:15363997-15364019 CCTGGGCTAGGGAAGGGGAAAGG + Intergenic
988020439 5:25614472-25614494 GCTGGGCTCCTGAATGGGGTGGG - Intergenic
989266017 5:39474975-39474997 ACTGGGATACAGAAGGTGTAGGG + Intergenic
990349190 5:54898938-54898960 GTTGGGCTACGGAAATGGGATGG - Intergenic
995142616 5:108749536-108749558 GCGGGGCTCCAGAAGCAGGAAGG - Intronic
995324086 5:110872247-110872269 ACTGGGCCACAGAAGGGTGGAGG - Intergenic
995387763 5:111607144-111607166 GCTGGGGAAGAGAAGGAGGAGGG - Intergenic
995934079 5:117487064-117487086 GTTGGGCTACAGCTGGTGGATGG - Intergenic
997300066 5:132797044-132797066 GTTGGGTCACAGAAGGTGGATGG + Intronic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
1000345116 5:160307847-160307869 GGTGGCCTACAGGAAGGGGAGGG + Intronic
1001980270 5:176033471-176033493 GGTGGGCTGAAGAAGTGGGAAGG + Intronic
1002093556 5:176818076-176818098 GCTGGGCTACAGCACGGAGGCGG - Intronic
1002237113 5:177810192-177810214 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1002352192 5:178590665-178590687 GGTGGGCTGCAGAAGGGGCGCGG - Intergenic
1002724316 5:181284157-181284179 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1003007680 6:2397063-2397085 GCTGGGCTGCTGAACAGGGAGGG - Intergenic
1006101409 6:31688396-31688418 GCTGTGCTATAGCAAGGGGAGGG - Intronic
1006509407 6:34513763-34513785 GCTCTGCTGCTGAAGGGGGATGG - Intronic
1007177526 6:39906956-39906978 GCTGGGCTAGAGGAGGGGTCTGG + Exonic
1011687251 6:89833339-89833361 GCTGGGGAACAGAACAGGGATGG + Intronic
1012211893 6:96529803-96529825 ACTGGGGTACAAAAGGGAGAAGG + Intronic
1012442498 6:99274184-99274206 GCCTGGCTTCAGAAGGGGAATGG + Exonic
1014703272 6:124715523-124715545 GCCTGGCTTCAGAAGGGGCATGG - Intronic
1015712678 6:136159381-136159403 GCTGGGGTTCAGATTGGGGATGG - Intronic
1016887392 6:148970823-148970845 GCTGGGCTAGAGAAATGAGATGG - Intronic
1018719070 6:166558567-166558589 GCTGGGCTGGGGCAGGGGGAGGG + Intronic
1018940956 6:168308626-168308648 GCTGGAGTACAGACGGTGGAGGG - Exonic
1020073170 7:5240685-5240707 GTGGGGCTACAGACAGGGGAGGG - Intergenic
1020844141 7:13261507-13261529 GCTGGGATACAGGAGGCTGAGGG - Intergenic
1021835578 7:24670203-24670225 CCTGGGTCACAGAAGGGGAAAGG - Intronic
1022469001 7:30670494-30670516 GGTGGGATGCAGAAGCGGGAGGG + Intronic
1023841704 7:44101916-44101938 CCTGGGCTACAGTGGGGGGCTGG - Intergenic
1023965849 7:44962745-44962767 GCTGGGCCAGAGCAGGGTGAAGG + Exonic
1026215100 7:68341620-68341642 TCTGTGCTAAAGTAGGGGGAAGG + Intergenic
1026814689 7:73501372-73501394 GTTGGACTACAGAAGGAGGGAGG - Intronic
1026949349 7:74337229-74337251 GCTGGGCTGCAGCTTGGGGAGGG + Intronic
1027459701 7:78436889-78436911 GCTGGTCCACTGCAGGGGGATGG + Intronic
1028653850 7:93179786-93179808 GCTGGGAGACAGGAAGGGGAGGG + Intergenic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1032467659 7:132156524-132156546 GCTGGGCATCAGGAGAGGGAAGG + Intronic
1032807749 7:135374154-135374176 GATGGGCAGCAGAAGGGGAAAGG - Intronic
1033229522 7:139585352-139585374 GCTGAGCTACAGAAGGCTGGGGG + Intronic
1033647107 7:143313961-143313983 GCTGGGCTGGAGTAGGGGGTGGG - Intergenic
1034074894 7:148222081-148222103 GCTGTCCTACAGATGGGTGATGG - Intronic
1034528555 7:151681386-151681408 TCTGGACTACAGAGGGGGAAGGG + Intronic
1036420072 8:8587176-8587198 GCTGGGTGACAGAAGGGGAATGG + Intergenic
1037640118 8:20734575-20734597 TCTGGGCTTCAGAAAAGGGAAGG - Intergenic
1043589173 8:81807991-81808013 GCAAGGCCACAGAAGGTGGATGG + Intronic
1046061904 8:109150355-109150377 GTTGGGCTAAAGAACGGGGAAGG + Intergenic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1048053355 8:130840231-130840253 GCTGGGGTTCAGAAGGCAGATGG + Intronic
1048277438 8:133077549-133077571 GCTGTGCCAGAGCAGGGGGATGG + Intronic
1049614146 8:143568986-143569008 GCTGGGCGACAGCAGGCGGGAGG + Intronic
1049955294 9:687576-687598 GCTGGGCAACAGCACTGGGAGGG - Intronic
1050223841 9:3427872-3427894 GCGGGGCACCAGAAGGGTGAAGG - Intronic
1051525291 9:18036216-18036238 GCTGGACTATAGAAAGAGGAAGG + Intergenic
1053886449 9:42647589-42647611 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1054225468 9:62455038-62455060 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1056089275 9:83188697-83188719 GCTGGGCTGCGGTAGGTGGAAGG - Intergenic
1056272535 9:84960368-84960390 CCTGAGCCACAGAAGGGAGAAGG + Intronic
1057272784 9:93660170-93660192 TCTGGGATACAGAAAGGAGAGGG - Exonic
1057837173 9:98454781-98454803 GCTGGGCTGCAGGATGGAGAGGG - Intronic
1057845784 9:98521390-98521412 GCTGGGCCACAGAAGGGTGCAGG + Intronic
1058108052 9:100997444-100997466 CCAGGGCTACTGAAGGGTGAAGG + Intergenic
1059166988 9:112086728-112086750 GGTGGGCAACAGAAGCGAGAGGG + Intronic
1060979242 9:127783240-127783262 GCTGGGGTTCAGACGAGGGATGG + Intergenic
1061491894 9:130949531-130949553 GATGGGCTACAGGTGGGTGATGG + Intergenic
1062028639 9:134352114-134352136 GCTGGGGTGCAGCAAGGGGAGGG + Intronic
1062102186 9:134734097-134734119 TCTGGGCTCCAGGAGGGGGTTGG + Intronic
1062264873 9:135682378-135682400 GCTGGGCTACGGGAGAGGCAGGG - Intergenic
1062352048 9:136144036-136144058 GCTGGGCTGCAGAAATGGGTGGG - Intergenic
1062698700 9:137888275-137888297 GCTGGGGCACGGAAGGGGAAAGG - Intronic
1203740060 Un_GL000216v2:171103-171125 GCTGGGCTGGAGCACGGGGACGG - Intergenic
1203377274 Un_KI270442v1:385647-385669 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1188050251 X:25475856-25475878 GCTGGAGAACAGAATGGGGAAGG - Intergenic
1189446389 X:41085254-41085276 GCTGGGCAGGAGCAGGGGGAGGG + Intergenic
1192317684 X:70065666-70065688 ACTGGGCTACAGTCTGGGGAAGG + Intergenic
1192318043 X:70067103-70067125 GCTTGGCTGCAGGAGGGGCATGG + Intergenic
1192486817 X:71534219-71534241 ACTGGGCTGAAGAATGGGGATGG - Intronic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1195367130 X:104137404-104137426 GCAGGGCTACAGTAGAGGCAGGG - Intronic
1196754899 X:119149374-119149396 GCTTGGCTCCAGGAGGGGAAAGG + Intronic
1196779937 X:119374845-119374867 GTGGGGCTAGAGAAGGGAGAAGG + Intergenic
1199794218 X:151179305-151179327 GCTAGGCTATAGGAGGGAGATGG + Intronic
1200306083 X:155027117-155027139 CCTGGGCTCCGGAAGGGGAAGGG + Intronic
1201175741 Y:11307557-11307579 GCTGGGCTGGAGCACGGGGATGG - Intergenic
1201179707 Y:11332971-11332993 GCTGGGCTGGAGCACGGGGACGG - Intergenic
1202603487 Y:26618443-26618465 GCTGCGCAACAGAAGGTGGGGGG - Intergenic