ID: 1081652339

View in Genome Browser
Species Human (GRCh38)
Location 11:44832758-44832780
Sequence CTGAACAAGGAGAAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081652339_1081652347 29 Left 1081652339 11:44832758-44832780 CCTGCAGCCTTCTCCTTGTTCAG 0: 1
1: 0
2: 1
3: 25
4: 270
Right 1081652347 11:44832810-44832832 TTATCCAGGTTCACTTATCCAGG 0: 1
1: 0
2: 1
3: 5
4: 99
1081652339_1081652345 15 Left 1081652339 11:44832758-44832780 CCTGCAGCCTTCTCCTTGTTCAG 0: 1
1: 0
2: 1
3: 25
4: 270
Right 1081652345 11:44832796-44832818 CCCACTGACTTCACTTATCCAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1081652339_1081652348 30 Left 1081652339 11:44832758-44832780 CCTGCAGCCTTCTCCTTGTTCAG 0: 1
1: 0
2: 1
3: 25
4: 270
Right 1081652348 11:44832811-44832833 TATCCAGGTTCACTTATCCAGGG 0: 1
1: 0
2: 2
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081652339 Original CRISPR CTGAACAAGGAGAAGGCTGC AGG (reversed) Intronic
901396971 1:8988694-8988716 CTGTCCAGGGAGAAGGATGCAGG + Intergenic
901905245 1:12403354-12403376 CTGAAAAAGAATCAGGCTGCGGG - Intronic
903765379 1:25730827-25730849 CTGAATCAGGTGAAGGGTGCAGG - Intronic
904381401 1:30113552-30113574 CTTAACACTGAGAAGGCAGCAGG + Intergenic
904648953 1:31989807-31989829 ATGAAAAAGGTGAAGGATGCCGG - Intergenic
905549207 1:38822706-38822728 GTGAAGAAGGAGGAGGCTGTGGG - Intergenic
906714392 1:47956108-47956130 CACAACAAGGAGGAAGCTGCTGG + Intronic
907573683 1:55506819-55506841 CTGAGGAAGGAGGAGGCTTCTGG - Intergenic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
907830774 1:58062211-58062233 CTGAACAAGGTGATGGCTATGGG - Intronic
908418036 1:63932435-63932457 CTGAACTAGAAAAAGGCTGTTGG + Intronic
908514337 1:64876512-64876534 CTTATTAAGGAGAAAGCTGCCGG - Intronic
912481696 1:109986243-109986265 CTGAACAAAGCAAGGGCTGCAGG + Intronic
912555418 1:110512654-110512676 CCCAACAAGGAGCAGGCTCCGGG - Intergenic
914725663 1:150325066-150325088 ATGGACAAGAAGAAGGCAGCCGG + Exonic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
915495410 1:156279138-156279160 GGGAAAAAGGAGAAGGCTGCAGG + Intronic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
918940752 1:190993352-190993374 TTGGACAAGGAGAAGGCAGGTGG - Intergenic
920020326 1:202950894-202950916 CTGAACAAGGGGATGACTCCTGG + Intronic
920920365 1:210293018-210293040 CTGGAAAAGGAGGAGGCTGTGGG - Intergenic
921662419 1:217820891-217820913 CTGCACAAGAAGCATGCTGCTGG + Intronic
921855241 1:219975139-219975161 CTGAAAAAGGAGAGGGCCACTGG + Intronic
922068286 1:222165905-222165927 CTGAAGAAGGAGAAAGCAGTAGG + Intergenic
924442989 1:244102368-244102390 GTGCAGAAGGAGAATGCTGCTGG - Intergenic
924910423 1:248506157-248506179 ATGAACATGGAGAAGACAGCAGG - Intergenic
924913677 1:248541882-248541904 ATGAACATGGAGAAGACAGCAGG + Intergenic
1063277536 10:4587498-4587520 CTGAACAAGAAGAAGGTCTCTGG - Intergenic
1063931285 10:11030759-11030781 CAGAACAAGTAGAAGATTGCTGG - Intronic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1065263932 10:23955608-23955630 CTGCCCAATGGGAAGGCTGCGGG + Intronic
1066473943 10:35726107-35726129 CTGTACAAGAAGCATGCTGCTGG - Intergenic
1069200793 10:65613276-65613298 CTGAACAAGGGGAAGTTTGCAGG - Intergenic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1072505832 10:96065629-96065651 CTGAAGCAGGAGAAAGCTCCAGG + Intergenic
1074431568 10:113399199-113399221 GTGGACATGGAGAAGTCTGCAGG + Intergenic
1076685097 10:132194994-132195016 CTGGTCAAGGAGAAGGGTGAGGG + Exonic
1077102096 11:827008-827030 CGGAGCAGGGACAAGGCTGCGGG - Intronic
1077681620 11:4247053-4247075 CTACAGAAGGAGAAGGATGCTGG - Intergenic
1078848712 11:15144520-15144542 AGGAACAGGGAGGAGGCTGCTGG - Intronic
1081362739 11:42200459-42200481 CTGCACTAGCAGAAGCCTGCGGG + Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081761864 11:45582234-45582256 GTGAACCAGGAAAAGGCTGGAGG + Intergenic
1081907190 11:46677552-46677574 CTCCCCAAGGACAAGGCTGCAGG + Exonic
1084187894 11:67484710-67484732 CTGAACAACGGGAAGGTTGTTGG - Intronic
1084992631 11:72942322-72942344 CTGTACAGGGAGCATGCTGCTGG - Intronic
1085249689 11:75134863-75134885 CTGAACAGGGAGCAGGCATCTGG - Intronic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1091308951 11:134559474-134559496 CTCTACAAAGAGAAGGCTGAGGG + Intergenic
1092757655 12:11778572-11778594 CTCCACAAGGAAAAGGCAGCAGG - Intronic
1094014584 12:25849250-25849272 CTGAATATGGAGAAGGCTCTTGG + Intergenic
1094052607 12:26237784-26237806 CTGAACAAGGAGAGGTCAGTGGG + Intronic
1094310447 12:29074839-29074861 CTGAAGAAGGAAAAGGCTTGTGG + Intergenic
1096912283 12:54996517-54996539 CTGAGCAAGCAGAACTCTGCAGG + Intergenic
1097243528 12:57592150-57592172 TTGACCAAAGAGAAGGCTGAGGG + Intronic
1100214050 12:92429202-92429224 ATGAGCAAGGAGATGGATGCTGG - Exonic
1100292896 12:93234614-93234636 CTCAACAAAGAGAAGGATGGGGG + Intergenic
1101838545 12:108311787-108311809 CTGACCCAGGACAGGGCTGCAGG + Intronic
1105289631 13:19043375-19043397 ATTAATAAGGAGAAGGCTGCTGG + Intergenic
1105289960 13:19047437-19047459 CTGAACAGGGTGGTGGCTGCAGG + Intergenic
1105684105 13:22760622-22760644 CTGAAAAAGAACAAGGCTGGAGG + Intergenic
1106987209 13:35369324-35369346 CAGAAAAAGGACAAAGCTGCAGG - Intronic
1107118492 13:36773048-36773070 CTCAACAAGGAGTAGGTTCCAGG - Intergenic
1107451335 13:40512778-40512800 CTGAAGAAGGGAAAGGGTGCAGG - Intergenic
1110950246 13:81478494-81478516 GTGAACAAAGAGAAAGCTGCTGG + Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1113468151 13:110526244-110526266 CTGAACAAGGATGAGGCTGCTGG + Intronic
1114196827 14:20485499-20485521 CTGAACAAGGGGAATGGTGATGG + Intergenic
1114259620 14:21026843-21026865 CTGGACAAGGAAAAGCCTGCTGG + Intronic
1114351118 14:21852533-21852555 CTGAACAAGGGAAACACTGCAGG - Intergenic
1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG + Exonic
1117340497 14:54787781-54787803 CTGAGGAAGGATAAGGCTGGTGG - Intronic
1117833845 14:59781215-59781237 GTGAACAAGCAGAAGGGAGCTGG - Intronic
1118621210 14:67615776-67615798 CAGAACAAGAAAAAGGCTGAAGG - Intergenic
1119070698 14:71580432-71580454 GGGGACAAGGTGAAGGCTGCTGG + Intronic
1119231073 14:72980287-72980309 CTGTAAAAGGAGAAGTGTGCAGG + Intronic
1119526986 14:75330667-75330689 CTGAACAAGGAAGGGGCTGTAGG + Intergenic
1120520185 14:85518497-85518519 CTGAATCAGAAGAAGGTTGCAGG + Intergenic
1121649969 14:95550633-95550655 GTGACCAAGGAAAAGGCTGGGGG - Intergenic
1122854969 14:104555712-104555734 CAGAACAAAGAGGAGGCTGGAGG + Intronic
1124061119 15:26294405-26294427 GTGGACAAGGTAAAGGCTGCAGG + Intergenic
1124362912 15:29052157-29052179 CTGAAGAAGTAGAACGTTGCTGG + Intronic
1125121841 15:36169080-36169102 CTGAACAAGGAGCAGACTTTTGG + Intergenic
1125159865 15:36630704-36630726 CTGTACAAGAAGCAGGGTGCTGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1130027890 15:80285586-80285608 CTGCACAAGGGGCAGGCTCCAGG + Intergenic
1131205916 15:90446737-90446759 CTGCCCCAGGAGAAAGCTGCAGG + Intronic
1131510760 15:93048338-93048360 CTGAACGAGGGGCAGGCTGCTGG + Intronic
1132063279 15:98710207-98710229 ATGGTCAAGGAGAAGGCTGCAGG - Intronic
1132213190 15:100041566-100041588 GTTAGCAAGGTGAAGGCTGCTGG + Intronic
1132372749 15:101309559-101309581 CTGAACAGGCAGGAGGCTGATGG - Intronic
1132753145 16:1468228-1468250 CAGGCCAAGGTGAAGGCTGCCGG + Intronic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1137372693 16:47923172-47923194 CTGAACATGTAGAAGGCACCTGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138113581 16:54342906-54342928 CTGAACAAACAGAAGCCTGTGGG + Intergenic
1138427607 16:56946622-56946644 CTGACAAAGGAGGAGGCTCCAGG + Intergenic
1138746629 16:59370232-59370254 CTGAAACAGGAGGAGGTTGCCGG - Intergenic
1143189257 17:5029790-5029812 CTGTACAAGGCAGAGGCTGCTGG - Intergenic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1143571803 17:7763964-7763986 CTGCTCAGGGAGATGGCTGCTGG + Exonic
1143637726 17:8176052-8176074 GTGAAAAAGGGGCAGGCTGCAGG + Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144325976 17:14180459-14180481 TTGAACAAGAGGAACGCTGCTGG + Intronic
1144429124 17:15174352-15174374 CTGGACCAGGAGAAGGTTGTAGG + Intergenic
1144474851 17:15577348-15577370 TTGAACAAGAGGAACGCTGCTGG + Intronic
1145043898 17:19597100-19597122 ATGAACAATCAGGAGGCTGCTGG + Intergenic
1147714207 17:42493380-42493402 CTGCACAAAGAGAAGACAGCTGG + Intronic
1147788081 17:42994622-42994644 CTGCCAAAGGACAAGGCTGCAGG + Intergenic
1147963929 17:44183198-44183220 CTGACTCAGGAGAAGACTGCTGG - Intergenic
1148002858 17:44400131-44400153 CTGAACAAGCAGGAGCCTGGGGG - Exonic
1148357123 17:46982896-46982918 CGGAAAAAGGAGAAGGCTTCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148840498 17:50493131-50493153 GGCAACAAGGAGAAGGCTGGAGG + Intergenic
1149034964 17:52123740-52123762 CTGTCCAGGGAGAACGCTGCAGG - Intronic
1149101536 17:52912219-52912241 CTGAACAAGGAAAATTCTGGTGG + Intergenic
1149990148 17:61378611-61378633 CTGGGCAGGGAGAAGGCTGGTGG - Intronic
1149996514 17:61408680-61408702 CTCAACAAGGATCAGGCTGCTGG + Exonic
1153434477 18:5054542-5054564 CTGAACTAGCAAAAGTCTGCTGG + Intergenic
1153763755 18:8355639-8355661 CTTAACAAGGAAAAGGTTACTGG + Intronic
1157905296 18:51564174-51564196 CTGGGCAAGGAGGAGGCTGCAGG + Intergenic
1158920084 18:62182020-62182042 ATTAAAAAGGAGAAGGCAGCCGG - Intronic
1159819681 18:73124412-73124434 ATGTACCAGGAGAAGGCTCCTGG - Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1160175465 18:76590527-76590549 CTGGACAGGGACATGGCTGCTGG - Intergenic
1161380451 19:3962238-3962260 CTGAAGGAGGAGGAAGCTGCAGG + Intronic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1164729877 19:30495489-30495511 CTGAACAAGCAGAGGCATGCTGG + Intronic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1165613022 19:37173303-37173325 CTGAATGAGTAGTAGGCTGCAGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166842083 19:45703654-45703676 CTGAAAAAGTAAAAGACTGCTGG + Exonic
1167333885 19:48872967-48872989 CTGAAGAAAGAGAGGGCTGGGGG + Intronic
1167684405 19:50947105-50947127 CTGAATACAGAGAAGGGTGCTGG + Intronic
1167752149 19:51387716-51387738 CTGAGCAAGGAATAGGCTGGAGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
926355686 2:12038864-12038886 CTGTAAAAGGAGAAGGGTCCAGG + Intergenic
928256672 2:29728919-29728941 CTTAATCAGGAGAAGGCAGCAGG - Intronic
928614986 2:33028852-33028874 GTTAACAAGGAAAAGGCTGACGG + Intronic
929938358 2:46311391-46311413 CAGAACCAGGAAAAGACTGCAGG + Intronic
931688928 2:64818723-64818745 CTGGGCAAGGAGCAAGCTGCAGG - Intergenic
932407674 2:71524600-71524622 CTGTCCAAGGAGTTGGCTGCTGG + Intronic
932882574 2:75517734-75517756 CTGACCAAGGAGGGGGCTGATGG - Intronic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
935054218 2:99551866-99551888 CTGGACTAGGAGAATGCAGCTGG - Intronic
935083989 2:99826914-99826936 ATGAACAAGGAGATAGCTGGAGG + Intronic
935572373 2:104675747-104675769 ATGAACAGGGAGAAGCCTCCAGG + Intergenic
935598918 2:104902156-104902178 TTGGGCAAGGAGAAGGTTGCAGG - Intergenic
935736214 2:106108536-106108558 AAGAACAATGAGAAGGCTGAGGG - Intronic
935815425 2:106842699-106842721 CTGAACAGTGAGAAGGACGCCGG + Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
937098110 2:119248711-119248733 CTGAACAAGGAGGGGGTGGCAGG + Intronic
937425725 2:121796983-121797005 CTGAAAAAGGAAAAGCCTGCTGG - Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
939202992 2:139062665-139062687 CTGAAGAAGGGGAAGTCTTCTGG - Intergenic
939753097 2:146073490-146073512 CTGAACAAAGAGAAGCCTTTTGG - Intergenic
940241356 2:151566561-151566583 CTGCACATGCAGAAGGCTGGTGG + Intronic
946054915 2:216892710-216892732 CTTAACAGGGAAAAGGATGCAGG + Intergenic
946161421 2:217838307-217838329 CTGAACATGGAGAAAGCTTTGGG - Intronic
947629371 2:231642003-231642025 AAGAAGAATGAGAAGGCTGCCGG - Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
948913148 2:241015906-241015928 GAATACAAGGAGAAGGCTGCCGG - Intronic
1169006897 20:2215083-2215105 CTGGCCAAGTGGAAGGCTGCTGG - Intergenic
1169950732 20:11040543-11040565 TTTATCAAGGAGAAGGCTCCAGG + Intergenic
1171278574 20:23878643-23878665 CTGTGCAGGGAGAGGGCTGCAGG + Intronic
1172071634 20:32261630-32261652 GAGACCAAGGGGAAGGCTGCTGG - Intergenic
1172078813 20:32321591-32321613 CTGAAAAAGAACAAGGCTGGAGG - Intronic
1173359632 20:42330795-42330817 AAGAACAAGCAGAATGCTGCAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1174376836 20:50131722-50131744 AGAAACAAGGAAAAGGCTGCTGG - Intronic
1174488348 20:50875029-50875051 CAGAAGAAGGAGAGGGCTCCCGG - Intronic
1174516419 20:51095760-51095782 CTGAACATGACGAAGGCAGCTGG - Intergenic
1174665402 20:52253492-52253514 TTGAATCAGGAGAAGGCTGAGGG + Intergenic
1175067111 20:56298538-56298560 ACAAACAAGTAGAAGGCTGCAGG + Intergenic
1175860944 20:62149695-62149717 CTGACCAATTACAAGGCTGCTGG - Intronic
1178617754 21:34148211-34148233 CTGAACATGGTCAAGGCTGGTGG - Intergenic
1179986546 21:44924934-44924956 CTGAAGACAGAGAAGGCTACGGG + Intronic
1180489099 22:15825345-15825367 ATGAATGAGGAGAAGCCTGCAGG + Intergenic
1182308452 22:29388062-29388084 CTGAACAACGAGGAGGCCTCAGG + Intronic
1183427632 22:37747905-37747927 CTGAGCAAGGGTAAGGCTGCCGG + Intronic
1183700605 22:39448883-39448905 CCGAACAAGGAGATGCCAGCTGG + Intergenic
1183778819 22:39985410-39985432 CCGAAGAAGGAGAAAGGTGCAGG - Intergenic
950950465 3:16992972-16992994 CTGGACAAGGTGAAGCCTACAGG + Intronic
951838991 3:27013328-27013350 CTTCACAAGGAGAAGGCTTTTGG - Intergenic
951862939 3:27274086-27274108 CTAAACAAAGAGTAGGCGGCAGG + Intronic
952357936 3:32601961-32601983 CTGAACAAGGGGAAGACAGCAGG - Intergenic
955164369 3:56496404-56496426 TTGAACAGGCTGAAGGCTGCCGG + Intergenic
955290639 3:57689516-57689538 CTGAACAAGGTGTTGACTGCAGG - Intronic
955368891 3:58333463-58333485 CTCAAAAAGGAAAAGGCTGGCGG - Intronic
956701781 3:71965253-71965275 CTAAACAAGCAGAAGGCTAGAGG - Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
961146146 3:124594875-124594897 CTGCACAATGAGAAGGCCCCAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
963039083 3:141055629-141055651 CTGAACTAGGGGAAAGCTGACGG + Intronic
964177582 3:153843113-153843135 ATGGAAAAGGAGAAGCCTGCTGG + Intergenic
965768186 3:172153525-172153547 CTGAGGAAGGAGCAGGCTGGGGG + Intronic
967388055 3:188929601-188929623 CTCCACAGGGTGAAGGCTGCAGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
968727306 4:2253733-2253755 CTGAAGAAGGAGGGGGCTGCTGG + Intronic
969289925 4:6232120-6232142 CCAAATAAGGAGAAGGCCGCAGG - Intergenic
969560422 4:7943277-7943299 GTGACCAGGGAGAAGGCAGCTGG - Intergenic
969896417 4:10309242-10309264 CTGACCTAGGAGAAGACTGGAGG + Intergenic
971654618 4:29327591-29327613 CTGACCAAGCAAAAGCCTGCAGG + Intergenic
972345425 4:38188725-38188747 CTGAGCAAGGATCAGGATGCAGG - Intergenic
975613167 4:76221206-76221228 GTGAAGCAGGTGAAGGCTGCTGG - Intronic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
976391049 4:84503911-84503933 CTGCACAAGGAGGCGGCAGCTGG - Intergenic
976391796 4:84513283-84513305 CTGATCAGAGAGAAAGCTGCGGG + Intergenic
977189429 4:93981201-93981223 CTGATCATGGAAAAGTCTGCAGG - Intergenic
978829680 4:113069170-113069192 TAGAACAAGGAGAGAGCTGCTGG + Intronic
980992329 4:139748524-139748546 CTGAAGGAGCAGGAGGCTGCTGG + Intronic
981025258 4:140071312-140071334 CTAAAGAAGGAAAAGGCTGGTGG - Intronic
981266946 4:142796386-142796408 CTTAACAGGGAGAAAGTTGCTGG + Intronic
981698471 4:147582604-147582626 CTGAACAAACACAAGGCAGCAGG + Intergenic
981798450 4:148627505-148627527 CTGAAACAGGAGATGACTGCAGG + Intergenic
982544092 4:156711108-156711130 ATGAATAAGCAGAAGACTGCAGG - Intergenic
983966799 4:173822737-173822759 CTGTACAATTAGAAGTCTGCTGG - Intergenic
985315838 4:188658407-188658429 CTGACCACTGAGAAGTCTGCTGG - Intergenic
985901490 5:2798771-2798793 GTGCTGAAGGAGAAGGCTGCTGG - Intergenic
986516633 5:8571409-8571431 CATATCAAGGAGGAGGCTGCTGG - Intergenic
987312026 5:16690447-16690469 CTGCCCAGGGAGGAGGCTGCTGG + Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988016849 5:25570306-25570328 GTGAACAAGGAAAAGACAGCGGG - Intergenic
988159650 5:27502971-27502993 ATGACCAGGGAGAAGTCTGCTGG - Intergenic
988924516 5:35976070-35976092 CTGAAAGAGCATAAGGCTGCAGG - Intronic
990616052 5:57509445-57509467 CTGAACATGGTGAAGCCAGCAGG - Intergenic
994046689 5:95318235-95318257 GGGAACAAGGAGTAGGCTGATGG - Intergenic
998332709 5:141343795-141343817 CTCAAGAAGGAGAACGCAGCTGG + Intronic
1000561329 5:162792660-162792682 CTTACCAATGAGCAGGCTGCCGG + Intergenic
1000641422 5:163707068-163707090 ATTAACAAGTGGAAGGCTGCAGG - Intergenic
1001084523 5:168691033-168691055 CTGAGGAAGGAAAAGGCTGCTGG - Intronic
1001719413 5:173844296-173844318 CTGAAAAAAGAGAATGCTGAGGG + Intergenic
1001719751 5:173847316-173847338 CTGAACAAGCAGCATGGTGCTGG + Intergenic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1005795667 6:29359446-29359468 TTGAACAAGCAGATGGCTGGGGG + Intronic
1006410386 6:33870303-33870325 CTGTGCAGGGAGAAAGCTGCAGG + Intergenic
1007712600 6:43834100-43834122 CTGACAATGGAGAAGGCTCCAGG - Intergenic
1008882910 6:56399674-56399696 CTGAACAGGCTGAAGGCAGCTGG + Intergenic
1010771850 6:79840956-79840978 CTGAACAAAGAGAAACCTCCAGG + Intergenic
1010774108 6:79865297-79865319 GTGCACAAGGTGAAGTCTGCTGG - Intergenic
1013198240 6:107864936-107864958 CTGAACCAGGAGCTGGCTGCAGG + Intergenic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1014586731 6:123206849-123206871 GTTAACAAGGAGAAAGATGCTGG - Intergenic
1015835423 6:137415437-137415459 CTCACCAAGGAAAGGGCTGCAGG + Intergenic
1015877037 6:137833202-137833224 CTGAAAAATGAAAAGGCTGCTGG + Intergenic
1016027715 6:139305148-139305170 ATGAACAAGGAGAAGGCTTTTGG - Intergenic
1016921610 6:149300559-149300581 CTGAATCAGGAAAAGGCTGAAGG - Intronic
1018246961 6:161832864-161832886 CCCAAGTAGGAGAAGGCTGCTGG - Intronic
1018813941 6:167317176-167317198 GGTAACAAGAAGAAGGCTGCTGG - Intergenic
1019701362 7:2476331-2476353 CTGGAGAAGGAGAACGGTGCAGG - Intronic
1019722943 7:2584071-2584093 CTGAAGCAGGAGCAGGCTCCAGG - Intronic
1022223003 7:28332594-28332616 CTGGCCCAGGAGAAGGTTGCTGG - Intronic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1026006062 7:66601246-66601268 CTGAACAGGGAGATGGTTGAGGG - Intergenic
1026389714 7:69888237-69888259 CTGTACAAGAAGAATGGTGCTGG + Intronic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1029173518 7:98647353-98647375 TTCAACAAGGACCAGGCTGCTGG - Intergenic
1029706234 7:102277838-102277860 CAGGTCAAGGAGAAGGCTGTGGG + Intronic
1030080620 7:105774651-105774673 CTTATTAATGAGAAGGCTGCGGG - Intronic
1030196396 7:106857694-106857716 CTGTACAGGGAAAGGGCTGCAGG - Intergenic
1031608585 7:123798301-123798323 CTGAGCAAGTAGAAGGGTGGAGG - Intergenic
1034395773 7:150824083-150824105 AAGAACAAAGAGAAGGCTGGAGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1036450831 8:8865922-8865944 CTGAACAAGGAGAGGTGTGGAGG - Intronic
1036987982 8:13557930-13557952 AAGAACAAGGAGAAGGTTGGAGG + Intergenic
1037058553 8:14477242-14477264 ATTAATAAGGAGAAGGCTGTTGG + Intronic
1037751809 8:21687115-21687137 CTGCACAAGCATGAGGCTGCTGG + Intergenic
1041006045 8:53497677-53497699 AAGAACAAGGAGCAGGCTCCTGG - Intergenic
1042811143 8:72826439-72826461 CTGGAAGAAGAGAAGGCTGCGGG + Intronic
1048489790 8:134882016-134882038 CTGAACGAAGAGGAGGCAGCTGG + Intergenic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048846859 8:138610441-138610463 CTGAGCGAGGAGAAGGATTCTGG - Intronic
1048941353 8:139403344-139403366 TGGGAAAAGGAGAAGGCTGCAGG - Intergenic
1049126612 8:140794955-140794977 CTGAACAATGGGAAGTATGCAGG - Intronic
1049600137 8:143503814-143503836 CTGAACATGGAGGAGGCGGTGGG - Intronic
1050703231 9:8365149-8365171 TTAAAAAAAGAGAAGGCTGCAGG + Intronic
1051034655 9:12729135-12729157 TTGAAGAAAGAGAAGGCAGCTGG + Intergenic
1056400033 9:86217925-86217947 AAGAACAAAGAGAAGGTTGCAGG - Intergenic
1058584056 9:106487737-106487759 CTGAACAAGGAGCATGATGGTGG + Intergenic
1059192728 9:112342193-112342215 CTGAGAAACTAGAAGGCTGCTGG - Intergenic
1059527439 9:115005624-115005646 CTGAACAAGGATCAGGGTCCGGG + Intergenic
1059744451 9:117186446-117186468 CTGAAGCAGGAGAATGGTGCGGG + Intronic
1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG + Exonic
1186920837 X:14278196-14278218 CTGAACAAAGAGAACGAAGCTGG + Intergenic
1189093217 X:38109713-38109735 TAGAACAAGCAGAAGGCTGGAGG + Intronic
1189566117 X:42242890-42242912 CAGAACAAGCAGAAGCCTGGTGG - Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1192858238 X:75037166-75037188 ATCAACAAGGAGAGGGTTGCTGG - Intergenic
1194776916 X:97976513-97976535 ATGAACAAAGAGAAGATTGCTGG - Intergenic
1200062878 X:153491443-153491465 CTGGCCAAGGAGATGGCAGCTGG + Intronic
1200314586 X:155118584-155118606 CTGAACAAGAAGCATGGTGCTGG + Intronic