ID: 1081654415

View in Genome Browser
Species Human (GRCh38)
Location 11:44848157-44848179
Sequence CTGTGTTAGGGAAGGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081654408_1081654415 4 Left 1081654408 11:44848130-44848152 CCAGCCTCAAAGTACCTTTTGAA 0: 1
1: 0
2: 2
3: 36
4: 405
Right 1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG 0: 1
1: 0
2: 3
3: 20
4: 163
1081654411_1081654415 -10 Left 1081654411 11:44848144-44848166 CCTTTTGAAGAGGCTGTGTTAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG 0: 1
1: 0
2: 3
3: 20
4: 163
1081654407_1081654415 5 Left 1081654407 11:44848129-44848151 CCCAGCCTCAAAGTACCTTTTGA 0: 1
1: 0
2: 3
3: 50
4: 389
Right 1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG 0: 1
1: 0
2: 3
3: 20
4: 163
1081654406_1081654415 13 Left 1081654406 11:44848121-44848143 CCACTGCACCCAGCCTCAAAGTA 0: 1
1: 31
2: 190
3: 1308
4: 5603
Right 1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG 0: 1
1: 0
2: 3
3: 20
4: 163
1081654409_1081654415 0 Left 1081654409 11:44848134-44848156 CCTCAAAGTACCTTTTGAAGAGG 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG 0: 1
1: 0
2: 3
3: 20
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081654415 Original CRISPR CTGTGTTAGGGAAGGCTGAC AGG Intronic
904454213 1:30637380-30637402 CTGTGACAGGGAAGGAGGACAGG - Intergenic
905143721 1:35870060-35870082 CGGTTTAAGAGAAGGCTGACAGG - Intronic
905203681 1:36330566-36330588 CTGTTTCAGGGACGCCTGACTGG + Intergenic
906203424 1:43974503-43974525 CTGGGTTAGGGAAGGCTTGCCGG + Intronic
909392418 1:75132644-75132666 CTGTGTTAGGGAAGCAGGGCGGG - Intronic
910239837 1:85074426-85074448 CTGTGCTAAGCAAGGCTGATGGG - Intronic
910537148 1:88311271-88311293 CTGTGTTAGGAAAGACTAAAGGG - Intergenic
912430058 1:109624240-109624262 CTGGCTTAGGGAAGGATTACAGG - Intronic
912804428 1:112744134-112744156 CAGGGTTAGGGACGGGTGACCGG - Intergenic
913319935 1:117581129-117581151 GTGTATTAGGGAAGGTTGGCAGG + Intergenic
918443765 1:184595782-184595804 TTGTGTTAGGAAAGACTGAATGG - Intronic
920159688 1:203986854-203986876 CTGAGATGGGGAAGGCTGAGGGG + Intergenic
920207745 1:204305210-204305232 CAGTGATAGGGAAGGCAGAGTGG - Intronic
920886680 1:209936744-209936766 CTGTTTTAAGGGAGGCTGCCTGG + Intergenic
921628273 1:217402546-217402568 ATGTGTTATGGAGGGATGACTGG + Intergenic
923144255 1:231186834-231186856 CTGGGCTGGGGAAGGCTGCCTGG - Intronic
923201979 1:231721696-231721718 ATGCCTTAGGGAAGGCTGAAAGG + Intronic
923703244 1:236319719-236319741 CTGTGTCAAGGAAGGCTCATGGG - Intergenic
1066661955 10:37745483-37745505 CTGTCCTAGGGAAGAATGACTGG - Intergenic
1068310138 10:55264958-55264980 CTGTCTCAGGGAAGGCTGCAAGG + Intronic
1068674119 10:59752543-59752565 ATGTGTAAGGGAAGCATGACAGG - Intergenic
1069292038 10:66791513-66791535 CTGAGTTTGGGAAGGCTTTCTGG - Intronic
1070560585 10:77563727-77563749 ATGTGTTAGGGGAGGATGAGAGG - Intronic
1070985506 10:80686566-80686588 CTGTGTTAGGGAAAGCATATAGG + Intergenic
1078750965 11:14163468-14163490 CTGAGTTTAGGGAGGCTGACTGG - Intronic
1079334964 11:19563282-19563304 CTGTGTTTGGGAAGAGAGACTGG - Intronic
1081630324 11:44685143-44685165 CAGTGTTAAGTAAGGCAGACAGG + Intergenic
1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG + Intronic
1084913841 11:72412665-72412687 CCATGTTAGGTAGGGCTGACAGG - Intronic
1085289079 11:75384511-75384533 CTGTGAAAGGGAAGGAAGACAGG - Intergenic
1086928613 11:92667970-92667992 CTGTCTCAGGGAAGGGTAACAGG + Intronic
1089157018 11:116410283-116410305 CTGTGGCAGGGAAGGAGGACAGG - Intergenic
1090187961 11:124750700-124750722 CTGTGCTGGGTAAGGCAGACTGG - Exonic
1090472569 11:126993298-126993320 CTGTGTTAGGGAAGTGGGAGAGG - Intronic
1090922963 11:131223190-131223212 CTGTGGTAGGTAAGGCTGATAGG + Intergenic
1093940779 12:25051622-25051644 CTGTGGTGGGGAAGGGTGATGGG + Intronic
1096527210 12:52217486-52217508 CTGTCTTGGGGCAGGCTGCCAGG - Intergenic
1096844478 12:54398300-54398322 CTGGGTCAGGGAAGGCTTCCTGG - Intronic
1098373149 12:69781315-69781337 CTCTGGTAGGGAATGCTAACGGG - Intronic
1100030082 12:90176156-90176178 CTGTGTTAAGGAAAGCTAAAAGG - Intergenic
1101655115 12:106713163-106713185 GTGTGTTTGGGAAAGCTCACTGG - Intronic
1103059402 12:117846882-117846904 CAGTGGTGGGGAAGGCTGGCTGG - Intronic
1106436681 13:29729537-29729559 CTGGGTTAGGGAAGCCTGGCTGG + Intergenic
1110602538 13:77391512-77391534 CTGTGTTAGGAAAGGAGGCCAGG + Intergenic
1111292481 13:86186965-86186987 CTGTCTCAGGGAAGGCTGCAAGG + Intergenic
1111417017 13:87960085-87960107 GTGTGTTAGGGAAGACTGATTGG - Intergenic
1114459815 14:22879146-22879168 CTGGGTTTGAGGAGGCTGACAGG - Exonic
1114927233 14:27419319-27419341 GTGTGTTGGGGAATGGTGACAGG + Intergenic
1117548875 14:56814143-56814165 CAGTGTTAAGGAAGTCTAACTGG - Intergenic
1119663489 14:76467582-76467604 TTGTGTTTGGGGAGGCAGACTGG + Intronic
1119720157 14:76884889-76884911 CTCTGCCAGGGAAGGCAGACGGG - Intergenic
1120220570 14:81728007-81728029 CTGTCTTAGGTAATGCTGACTGG - Intergenic
1121195507 14:92068210-92068232 TGGTGTTAGAGAAGGCTGACTGG - Intronic
1121869798 14:97396661-97396683 GTGTATCAGGGAAGGCTGCCTGG - Intergenic
1124665729 15:31590835-31590857 GTGCCTTAGGGAAGGCTGGCTGG + Intronic
1124861388 15:33445267-33445289 CGGTGATAGGGAACGCTGATGGG + Intronic
1128665200 15:69532503-69532525 TTGGGTGGGGGAAGGCTGACTGG + Intergenic
1129550712 15:76445862-76445884 TGGTGTTAGAGAAGGCTGAGTGG - Intronic
1132101808 15:99029039-99029061 CTTTGTTAGGGAGGGGTGGCAGG - Intergenic
1132724324 16:1332343-1332365 CTGTGTTCTGGAAGCCTGTCTGG + Intergenic
1133456012 16:5943123-5943145 CTGTGTTAGGGATGTGTGTCTGG - Intergenic
1136867160 16:33767670-33767692 CTGGGTTAGGAAAGGCTGACTGG + Intergenic
1138336422 16:56257142-56257164 CTGTGGTGGGGAAGGCTGAAAGG + Intronic
1139264347 16:65624989-65625011 CAGTGTTATGGAAGGCTTAAGGG - Intergenic
1203105002 16_KI270728v1_random:1348533-1348555 CTGGGTTAGGAAAGGCTGACTGG - Intergenic
1203128512 16_KI270728v1_random:1613835-1613857 CTGGGTTAGGAAAGGCTGACTGG + Intergenic
1142630146 17:1220351-1220373 CTGTCTGAGGGGAGGCTGCCTGG - Intronic
1144262997 17:13541502-13541524 ATGTGTTTGGGAAGGTGGACAGG - Intronic
1146576907 17:34002077-34002099 TTGAGTTAGAGAAGGCTGCCTGG - Intronic
1147038652 17:37700530-37700552 CTCTTTTAGGGAAGGCAAACAGG + Intronic
1147051895 17:37801362-37801384 CTGAGTAAAGGCAGGCTGACAGG + Intergenic
1148494519 17:48045366-48045388 CTGTGGGAGGGCAGGCTGGCTGG - Intergenic
1150712909 17:67546785-67546807 CTGTGGGAGGCAAGGCTGCCGGG - Intronic
1151884656 17:76916393-76916415 CTGTGTTGGGGAGGGCTGCAAGG + Intronic
1152243597 17:79173576-79173598 GTGTGTTTTGGAAGGTTGACCGG - Intronic
1152341726 17:79729373-79729395 CTGGGTTAGGAAAGGCTGGCTGG + Intergenic
1155267436 18:24107270-24107292 GTGTGTTAGAGAAGGATGAAAGG - Intronic
1158982382 18:62776134-62776156 CAGTTTTAGGGCAAGCTGACAGG + Intronic
1160051507 18:75438337-75438359 CTGCGATAGGGAAGGCTGTGAGG + Intergenic
1165639325 19:37370885-37370907 CTGTGTTGGGGAAAGCGGCCAGG - Intergenic
1166091507 19:40512455-40512477 GGGTGTCAGGGAAGGCTGCCTGG + Intronic
1166247398 19:41538822-41538844 CTGTCTCGGGGAAGGCTGCCAGG + Intergenic
1166643233 19:44512245-44512267 CTGGGTTAGGTAAGGCTGTTTGG + Intronic
1167232360 19:48292952-48292974 GTGTGGTGGGGAAGGCTCACTGG - Intergenic
927108563 2:19848103-19848125 CTGGGTTGGGGAAGGCAGCCTGG - Intergenic
928573190 2:32628461-32628483 CTGTGTTAGGGAAAAATGAAGGG - Intronic
929784283 2:44977954-44977976 CTGTTCTAGGGAAGGCTTGCTGG + Intergenic
932781031 2:74558593-74558615 CTCTGTGAGTGAGGGCTGACTGG - Exonic
936755092 2:115698789-115698811 TTTTGTTATGGAAGGCTGAAAGG + Intronic
936970687 2:118173695-118173717 AGGTGTTAGGAAAGGCTGTCTGG + Intergenic
937854869 2:126664881-126664903 CTGTGTTAGTGAAGTCCCACAGG - Intronic
938202682 2:129388276-129388298 ATGTGGTAGGGAATGCTGAGGGG - Intergenic
938772219 2:134510439-134510461 CTGGGATTGGGAAGGCTGAAGGG + Intronic
941186471 2:162326122-162326144 CTGTCTCAGGGAAGGCTGCAAGG - Intronic
942043334 2:172085129-172085151 CGGTGTTAGGGACCGCTGAAGGG + Intronic
944133450 2:196371780-196371802 CTGGGTTAGGAGAGGCTCACTGG - Intronic
944658259 2:201898495-201898517 CTGTGATAGGGCAGACTGATAGG - Intergenic
945193850 2:207219349-207219371 CTGGGTTAGGGAAGGGGTACGGG - Intergenic
946413992 2:219530208-219530230 CTCTGTTAGGGAAGCCTGGCAGG + Intronic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
1169448961 20:5695260-5695282 CTGTCTTAGAGAAGGCAGAGAGG - Intergenic
1172572544 20:35981949-35981971 CTGGGTCAGGGAAGGCTTCCTGG + Intronic
1172825503 20:37780012-37780034 GTGTGTGGGGGAAGGCTGAGGGG + Intronic
950182654 3:10926346-10926368 CAGTGTTTGGGAAGGCTTAGAGG - Intronic
950756795 3:15180049-15180071 CTGTTCCAGGGATGGCTGACTGG + Intergenic
955663516 3:61326346-61326368 CTGTGAATGGGAAGGCTGTCTGG - Intergenic
958745923 3:98134330-98134352 CTGAATTAGGGAAGGCTTCCAGG - Intergenic
960108722 3:113824862-113824884 CTGTGTAAGCAAAGGGTGACTGG + Intergenic
960980147 3:123216296-123216318 CTGTGTTAGGGAAGTGAGAAAGG + Intronic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
963040217 3:141064882-141064904 CTGTCTCAGGGAAGGCAGTCTGG + Intronic
963256474 3:143149747-143149769 ATGTGTTAGGGAAGGTGGCCAGG + Intergenic
964838241 3:160964625-160964647 CAGTGTTTGGGAAGGCAGAGGGG + Intronic
967182023 3:186913488-186913510 CTGGCTTAGGGAAGGCACACAGG - Intergenic
969662175 4:8536725-8536747 CTGACTGAGGGAAGGCAGACAGG + Intergenic
970762503 4:19507875-19507897 CTGAGTGAGGGAAAGCTGCCTGG - Intergenic
976615957 4:87077258-87077280 TTCCATTAGGGAAGGCTGACTGG + Intronic
977252231 4:94702127-94702149 CTGTGGGAGGGAAGTCTCACTGG + Intergenic
985817030 5:2134727-2134749 CTGGGGTATGGAAGCCTGACGGG + Intergenic
986651145 5:9964493-9964515 CTCTTTTGGGGAAGGCTGAAGGG - Intergenic
991662390 5:68963087-68963109 CCGTGCTGGGGAAGGGTGACCGG + Intergenic
992336800 5:75779515-75779537 TTGTGTTGGGGAAGGTTGATAGG - Intergenic
993723063 5:91340892-91340914 ATGAGTTAAGGAAGGCTTACTGG + Intergenic
1002843082 6:922753-922775 CTGTCTCAGGGAAGGCTGCAAGG + Intergenic
1004335223 6:14758238-14758260 CTCTGCTAGGGAAAGCTGTCTGG + Intergenic
1004406558 6:15338590-15338612 CTGTCTCAGGGAAGGCTGCAAGG + Intronic
1004631244 6:17423324-17423346 TTGTTTTAAGGAAGGCTGCCAGG + Intronic
1004865417 6:19848696-19848718 CTGTGTTAGGGGAGACTCTCAGG - Intergenic
1005245678 6:23881803-23881825 ATGGGTTGGTGAAGGCTGACAGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006557483 6:34880300-34880322 CTGCCTTAGGGAAAGCTGAGCGG + Exonic
1007067166 6:39002245-39002267 CTATGTTAGGGAAGACAGAGGGG - Intronic
1007139852 6:39561011-39561033 CTGCATTATGGAAGGCTGACTGG + Intronic
1007171874 6:39869803-39869825 CTGGGTTAGGGAAGGCCGGTTGG + Intronic
1007540868 6:42643049-42643071 GTGTGTCAGGGAAGGCTTCCTGG - Intronic
1016301187 6:142633548-142633570 CAGTGTTTGGGGAGGCTGAGGGG + Intergenic
1018807930 6:167275684-167275706 GTGTGGTGGGGAAGTCTGACTGG - Intronic
1020561275 7:9730568-9730590 CTGGGTTAAGCAAGGCTGAAGGG - Intergenic
1020997051 7:15278492-15278514 CTGTGATAGGGATGGGTGACTGG + Intronic
1022026989 7:26457793-26457815 CTCTGTGAGGGATGGCTCACTGG + Intergenic
1023255092 7:38305167-38305189 CTGTATTAGGGAAGCTTGACAGG + Intergenic
1023780565 7:43651525-43651547 CTGGCTGAGGGGAGGCTGACAGG - Intronic
1024299868 7:47878829-47878851 CTGCGGGAGAGAAGGCTGACAGG + Intronic
1024349456 7:48348848-48348870 ATGTGTTAGGCAGGGCTGTCTGG + Intronic
1024880334 7:54078588-54078610 CTATGTTAGGGAAAGTTCACGGG + Intergenic
1026648314 7:72192517-72192539 TTGTGATAGGGAACTCTGACAGG + Intronic
1026772897 7:73213361-73213383 CCGTGTCAGGGAAGGCTTCCAGG + Intergenic
1027013760 7:74766757-74766779 CCGTGTCAGGGAAGGCTTCCAGG + Intergenic
1027074278 7:75179275-75179297 CCGTGTCAGGGAAGGCTTCCAGG - Intergenic
1027453285 7:78357774-78357796 CTGTGTTTGAGAAGGTTAACTGG - Intronic
1028889194 7:95967866-95967888 CTGTGTTAGTGCAGGCAGACTGG + Intronic
1028979510 7:96951762-96951784 CTGTGTTAGGATATGCAGACAGG - Intergenic
1029853078 7:103484868-103484890 CTGTTTTAGGAAAGGCTGTCTGG + Intronic
1030361803 7:108603161-108603183 CTGTGGTAGTGAAGTCAGACTGG - Intergenic
1032266449 7:130373518-130373540 CTGTGTGAGGCCAGGCTGGCCGG + Intergenic
1037692528 8:21194297-21194319 TTCTGTTAGGGAAGCCTGAATGG - Intergenic
1037700209 8:21267070-21267092 CTCTGTCAGGGGAGGATGACAGG - Intergenic
1037700820 8:21272439-21272461 CTGGGTTAGGGAAGCCTGTCTGG - Intergenic
1047327678 8:123855251-123855273 ATGTGTTTGGGGAGCCTGACTGG + Intronic
1047609153 8:126504048-126504070 CTGTGTTGGGGCAGTCTGATAGG - Intergenic
1048435301 8:134410929-134410951 ATGTGTTGGGGAAGACAGACTGG - Intergenic
1048611023 8:136023204-136023226 CTTTGTTAAGAAAGGCTGTCAGG - Intergenic
1048884044 8:138894345-138894367 CTGTGTTATGGAAGGTTGTTGGG - Intronic
1049248345 8:141574868-141574890 CTGCATTAGGGAAGGCTTCCTGG + Intergenic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1050975144 9:11928481-11928503 CTGTTTTACGGAAAGCTGATTGG + Intergenic
1057211679 9:93204017-93204039 GGGTGTCAGGGAAGGCTGGCTGG + Intronic
1058485730 9:105441927-105441949 CTGTGTTAGAGAAACCTGGCTGG + Intergenic
1058761321 9:108136172-108136194 CTTTATTAGGGAAGGCTCTCAGG - Intergenic
1060779520 9:126401128-126401150 CAGTGTTAGGGAAAGGTCACAGG - Intronic
1062209062 9:135353410-135353432 CTGTGCAAGGGAAGACAGACGGG + Intergenic
1062730780 9:138107160-138107182 CTGAGATAGGGAAGGCTGTGGGG - Intronic
1203777422 EBV:81577-81599 CTGTGTCAGGGATGGCTCCCAGG - Intergenic
1186290156 X:8088736-8088758 GTGTGTTGGGAAAGGCTGAAGGG - Intergenic
1187468849 X:19550715-19550737 CTGTGTAAGGACAGGATGACTGG + Intronic
1187552375 X:20318810-20318832 CTGGGTGAAGGAAGGCTGACAGG - Intergenic
1187651295 X:21410944-21410966 TTGTATTAGGGAAGGATCACAGG + Intronic
1187857809 X:23654099-23654121 CTGGGTTGGAGAAGGCTGGCAGG + Intergenic
1188163305 X:26829411-26829433 CTGTCTTAGGGAAGACTTACTGG + Intergenic
1188644295 X:32545293-32545315 CTGTGTTAGTGATGGCTGAGTGG + Exonic
1195427186 X:104747582-104747604 CTGACTTAGGGAAGGGGGACAGG + Intronic
1195837536 X:109134040-109134062 CAGTGTTAGGTAAGGCTCTCCGG - Intergenic
1197176297 X:123489199-123489221 CAGTGTTTGGGAAGACGGACTGG + Exonic
1198228223 X:134666146-134666168 CTGAGTTAGGGAAGGCAGAATGG - Intronic
1199909668 X:152272031-152272053 CTGTGTTAGGGCAGTGTGAAAGG + Intronic
1200275097 X:154724539-154724561 CTGTGGCAGGAAAGGCTGATGGG - Intronic
1200930047 Y:8688773-8688795 CTCTGTTAAGGCAGGCTGACAGG - Intergenic