ID: 1081654624

View in Genome Browser
Species Human (GRCh38)
Location 11:44849289-44849311
Sequence AAGCAGGACCTGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081654619_1081654624 3 Left 1081654619 11:44849263-44849285 CCTGTGTTTTAGGTGGGGGTCCC 0: 1
1: 0
2: 1
3: 15
4: 85
Right 1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG 0: 1
1: 0
2: 4
3: 40
4: 392
1081654612_1081654624 16 Left 1081654612 11:44849250-44849272 CCTTTGTGAGCTCCCTGTGTTTT 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG 0: 1
1: 0
2: 4
3: 40
4: 392
1081654618_1081654624 4 Left 1081654618 11:44849262-44849284 CCCTGTGTTTTAGGTGGGGGTCC 0: 1
1: 0
2: 3
3: 7
4: 144
Right 1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG 0: 1
1: 0
2: 4
3: 40
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081654624 Original CRISPR AAGCAGGACCTGAGTGAGGA TGG Intronic