ID: 1081654624

View in Genome Browser
Species Human (GRCh38)
Location 11:44849289-44849311
Sequence AAGCAGGACCTGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081654619_1081654624 3 Left 1081654619 11:44849263-44849285 CCTGTGTTTTAGGTGGGGGTCCC 0: 1
1: 0
2: 1
3: 15
4: 85
Right 1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG 0: 1
1: 0
2: 4
3: 40
4: 392
1081654618_1081654624 4 Left 1081654618 11:44849262-44849284 CCCTGTGTTTTAGGTGGGGGTCC 0: 1
1: 0
2: 3
3: 7
4: 144
Right 1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG 0: 1
1: 0
2: 4
3: 40
4: 392
1081654612_1081654624 16 Left 1081654612 11:44849250-44849272 CCTTTGTGAGCTCCCTGTGTTTT 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG 0: 1
1: 0
2: 4
3: 40
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081654624 Original CRISPR AAGCAGGACCTGAGTGAGGA TGG Intronic
900109797 1:1000580-1000602 AACCGGGACCGGAGTGGGGACGG - Intergenic
900111186 1:1006271-1006293 CAGCAGGACCTGAGACAGGGCGG - Intergenic
901199208 1:7457327-7457349 AACGACGACATGAGTGAGGAGGG - Intronic
901424020 1:9169745-9169767 AGCCAGCATCTGAGTGAGGAGGG - Intergenic
901935125 1:12621460-12621482 AAGCAGAGCCTGATTCAGGAGGG - Intergenic
902196445 1:14802031-14802053 AAGCAGGGCATGACAGAGGAAGG - Intronic
902620187 1:17646288-17646310 GGGCTGGACATGAGTGAGGAAGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903000336 1:20260973-20260995 AAGAAAGAACTGAGTGTGGAGGG - Intergenic
903560672 1:24224749-24224771 TGGCAGGTCCTGAGTCAGGAAGG + Intergenic
904384077 1:30130282-30130304 CAGCAGGAGCTGGCTGAGGAGGG + Intergenic
904560549 1:31394564-31394586 AAGCTGGCCCAGAGAGAGGAAGG + Intergenic
904877377 1:33666668-33666690 AACCAGGACCTGTGTAAGGCTGG + Intronic
905388509 1:37621217-37621239 AAGCAGGGGCTGGATGAGGAAGG + Intronic
906101997 1:43269975-43269997 AAGCAGGATTTGAGTGAACAGGG - Intronic
906115271 1:43352465-43352487 AAGCAGATCCTGTGGGAGGAGGG - Intronic
906990354 1:50730908-50730930 AAGAAGGACATGAGTTGGGAGGG - Intronic
907872363 1:58454666-58454688 AATCAAGCCCTGGGTGAGGAGGG - Intronic
908166602 1:61464965-61464987 AAGTAGGACCTGAGTGGAGAGGG + Intergenic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
910828950 1:91440381-91440403 AAGCAGGGGCTGAGGAAGGAGGG + Intergenic
911064989 1:93780053-93780075 AAGCAGGCCCTGAGGGTGGGAGG - Intronic
912389210 1:109290305-109290327 AAGCAGGACCTAGGTCAGGAAGG - Intergenic
912537463 1:110385602-110385624 AAGCAGGGGCTGAGGGAGGGAGG - Intronic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
913183428 1:116344696-116344718 GAGGAGGCCCTCAGTGAGGAGGG - Intergenic
914450658 1:147788465-147788487 AACTGGGATCTGAGTGAGGACGG + Intergenic
914877741 1:151524898-151524920 GAGCAGGGTCTGAGAGAGGAGGG + Intronic
915778450 1:158517901-158517923 AAGCAGGATCTGTGGGTGGATGG + Intergenic
917043056 1:170827810-170827832 GTGCAGGACTGGAGTGAGGAAGG + Intergenic
918761844 1:188420524-188420546 AAGGAGGAAGGGAGTGAGGAAGG - Intergenic
918761871 1:188420613-188420635 AAGAAGGAAGGGAGTGAGGAAGG - Intergenic
920380418 1:205531756-205531778 AGGCAGGTCCTGGGGGAGGAGGG - Exonic
922359604 1:224809442-224809464 AAACAGGACCTAAAGGAGGAGGG + Intergenic
923097750 1:230788958-230788980 AAGCAGGACATGAGTCAAGGAGG - Intronic
923464278 1:234234367-234234389 AAGCCGGAGCCGAGAGAGGAAGG + Intronic
1063112158 10:3046752-3046774 AAGCAGGACATGAGTGGGGAGGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070568302 10:77620386-77620408 AAGCAGGAGCTGTGGGAGGGAGG + Intronic
1070748832 10:78951890-78951912 AAGGTGGGCCTGAGTGAGGAGGG - Intergenic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1070967201 10:80536731-80536753 TAGCTGGACCTGGGTGGGGAGGG + Intergenic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071457049 10:85858950-85858972 AAGCAGGACATGACTCAGAAAGG + Intronic
1073440111 10:103547521-103547543 AAGCTGGACCTGGGAGAGGCAGG + Intronic
1074287942 10:112115995-112116017 CAGCAGGTCCCCAGTGAGGAGGG - Intergenic
1074422519 10:113322026-113322048 AAGCAGAACCTGGGGGAGGGGGG + Intergenic
1074522801 10:114240116-114240138 AAGCAGAACCTGAGAGGGGCCGG + Intronic
1076316653 10:129546613-129546635 AAGAAGGACCAGAGAGAGAATGG + Intronic
1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG + Intronic
1076888783 10:133274227-133274249 GTGCAGGCCCTGAGCGAGGAGGG + Exonic
1077538749 11:3136603-3136625 AAACAGGGCCTGAGAGATGAAGG - Intronic
1078874261 11:15378049-15378071 AAGCAGGTGCTGAGGGAGGGAGG + Intergenic
1081218912 11:40436538-40436560 AAGCAGGACAGGAGAGAGGCTGG - Intronic
1081222836 11:40483217-40483239 CAGCAGGAGCTGACTGAGGCTGG + Intronic
1081508208 11:43740202-43740224 TAGCATGAATTGAGTGAGGAGGG + Intronic
1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG + Intronic
1081782023 11:45719655-45719677 AAGTAGGGCCTGGGTAAGGAGGG - Intergenic
1084494326 11:69495318-69495340 TAGCAGGTCTTAAGTGAGGAGGG + Intergenic
1085632635 11:78131842-78131864 ATGAAGGGCCTGAGTGAAGATGG - Intronic
1085932215 11:81097331-81097353 AAGCAGGACCTGATGCTGGAAGG + Intergenic
1087128315 11:94647423-94647445 AGCCAGGACTTGCGTGAGGAAGG - Intergenic
1087274881 11:96151189-96151211 AGGCAGGAGCTGAGGAAGGATGG - Intronic
1088384826 11:109242145-109242167 AGGCAGGACATGAGTGTGGTGGG + Intergenic
1088644977 11:111910876-111910898 AAACAGGAGCTGAGTGGGCAAGG - Intronic
1089260148 11:117218703-117218725 AAGCAGGAGCTGAGGGCTGAAGG - Intronic
1089852888 11:121515564-121515586 AAACAGGACCTAAGAGAGCAGGG + Intronic
1091219687 11:133922697-133922719 CAGCCGGACCTGACCGAGGATGG - Exonic
1091276498 11:134356259-134356281 AACCAGGAGCTGAGTGTGCAGGG - Intronic
1091407139 12:216097-216119 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407152 12:216192-216214 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407165 12:216287-216309 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407182 12:216382-216404 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407195 12:216477-216499 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407211 12:216572-216594 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091947023 12:4555738-4555760 TAGAAGGAGGTGAGTGAGGATGG - Intronic
1092282328 12:7108003-7108025 AAGCAGGCCCTGCGTTTGGAAGG - Intronic
1092621742 12:10279151-10279173 AACCAGGACCTGCTTGAGGGTGG - Intergenic
1092751450 12:11723378-11723400 AAGCAGGACATGGGAAAGGAGGG - Intronic
1093372389 12:18380192-18380214 AAGAAGGACCTGAGTAAGCACGG - Intronic
1093832223 12:23776382-23776404 AAGAAGGATATGACTGAGGAAGG + Intronic
1095402474 12:41830811-41830833 AAGCAAGACCAGAGGGAGGGAGG + Intergenic
1096298217 12:50401665-50401687 AAGCAGCAGCTGCGTGATGAAGG + Intronic
1096577258 12:52560545-52560567 TTTCAGGACCTGGGTGAGGATGG + Intergenic
1097017521 12:55997879-55997901 CAGCAGGGCCAAAGTGAGGAGGG - Intronic
1097696711 12:62781716-62781738 AAGAAGTACCTGAGAGAGGAAGG + Intronic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1102081808 12:110104372-110104394 AAGCAGGAGCTGAGGGCTGATGG - Intergenic
1102308734 12:111827120-111827142 ATGCTGCACCTGAGTGAGGCTGG + Intergenic
1103163943 12:118754075-118754097 CAGCATGTCCTGAGTGAGCAGGG + Intergenic
1103424989 12:120825995-120826017 AAGCAGGGCAAGAGTTAGGACGG + Intronic
1103832470 12:123790749-123790771 AAAGAGGACAGGAGTGAGGAAGG + Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104863515 12:131938642-131938664 AACCAAGAGCAGAGTGAGGAAGG - Intronic
1105256154 13:18745077-18745099 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1105784584 13:23735762-23735784 AATCAGGACCTGAGCCTGGAAGG + Intronic
1105934657 13:25088057-25088079 AGGCAGGAGCTGACTGAGGCTGG - Intergenic
1107559104 13:41544579-41544601 AAGCAAAACTTGAGTGAGGATGG + Intergenic
1108092627 13:46865159-46865181 TACCAGGAAGTGAGTGAGGAAGG - Intronic
1108133029 13:47323722-47323744 AAGCAGGAACTGTCTAAGGAAGG - Intergenic
1108289306 13:48942364-48942386 AGGGAGTATCTGAGTGAGGAGGG + Intergenic
1108604253 13:52021565-52021587 ACACAGGACTTGAGTGAGCAGGG + Intronic
1109838323 13:67887881-67887903 AATCAGGACACGAGTGTGGAAGG - Intergenic
1111162751 13:84417366-84417388 TAACTGGAGCTGAGTGAGGAAGG + Intergenic
1112119520 13:96394431-96394453 ATGCAGGACAGGAGTGAGGATGG - Intronic
1112264541 13:97911291-97911313 AAGCAAGACCTTAGTAAGGTAGG + Intergenic
1113362706 13:109645674-109645696 CAGAAAGACCTGAGTCAGGAGGG - Intergenic
1114482257 14:23043130-23043152 AAGCAGGACTTGGTTGGGGATGG + Exonic
1114556341 14:23564497-23564519 AAGCAGGACCTGTGTGGGTGAGG + Intronic
1115740623 14:36383970-36383992 AAGTAGAACCTCAGTGATGATGG - Intergenic
1117455563 14:55893668-55893690 AAGCAATATCTGAGTAAGGAGGG + Intergenic
1117736573 14:58774309-58774331 AAGGAGGAAATGAGGGAGGAAGG - Intergenic
1117814662 14:59584608-59584630 GAGCAGGAGCTCATTGAGGAAGG - Intergenic
1118336813 14:64860426-64860448 AAACAGGACCTGAGAGGGCAGGG + Intronic
1118481867 14:66175359-66175381 GAGCAAGGCCTGTGTGAGGATGG - Intergenic
1118536064 14:66766021-66766043 AAGCAGGACTTGAGGGATAATGG + Intronic
1118764677 14:68901870-68901892 AAGCAGAACCTCTGGGAGGAAGG - Intronic
1120677984 14:87443947-87443969 AGGCAGGACCTGACTCAAGAAGG - Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121991552 14:98562600-98562622 AAGCAACACCTGTGTCAGGAGGG - Intergenic
1122115041 14:99523360-99523382 GAGCTGGACCTCAGTGAGGCTGG - Intronic
1124163500 15:27296071-27296093 GAGCAGGACCTGGGTGGAGAAGG + Intronic
1124500239 15:30221916-30221938 AAGCAGGAGCTGAGGGAGTCAGG - Intergenic
1124617899 15:31255846-31255868 AGGAAGGACCTGAGGGAGGGCGG + Intergenic
1124693636 15:31845782-31845804 AGGGAGGGCCTGAGTGAGCATGG + Intronic
1124743336 15:32316750-32316772 AAGCAGGAGCTGAGGGAGTCAGG + Intergenic
1125685289 15:41559890-41559912 AAGCAGAACCTTGGAGAGGATGG + Intronic
1127267111 15:57371336-57371358 CAGCAGGCCCAGAGTGTGGATGG + Intergenic
1127714913 15:61640592-61640614 GAGCAGAGACTGAGTGAGGAAGG + Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1129207414 15:74045265-74045287 AGGGAGGTCCTGAGTGAGGAAGG + Exonic
1129244610 15:74271807-74271829 CAGGTGGACCTGGGTGAGGAGGG + Intronic
1129338560 15:74869628-74869650 AACCAAGACCTCAATGAGGATGG - Intronic
1130965329 15:88693446-88693468 CAGCAGGCCCTGGGTCAGGAAGG - Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1132270541 15:100520247-100520269 GAGCAGGACATAAGTGAGGCTGG + Intronic
1132606213 16:794795-794817 AAGGAGGGGCTGAGTGAGGCTGG + Intronic
1132625521 16:889737-889759 AAGGAGGACCTGATTCCGGAAGG - Intronic
1133839504 16:9394771-9394793 AAGCAGGAAGGGAGGGAGGAAGG - Intergenic
1134904954 16:17972244-17972266 AAGGAGGAGCTGAGCAAGGATGG - Intergenic
1135732531 16:24906926-24906948 AGGCAGAACCTCAGGGAGGACGG - Intronic
1135856353 16:26014500-26014522 CACCAGGACCTATGTGAGGATGG - Intronic
1135974037 16:27095514-27095536 AACCAGGACTAGAGTGAGGTAGG - Intergenic
1136179225 16:28539338-28539360 ATGCAGGACGTGAGGAAGGAGGG + Intergenic
1136634435 16:31510647-31510669 CAGCATGTCCTGAGTGGGGAGGG + Intergenic
1137766900 16:50984897-50984919 AAACAGGACCTGCGTAAGGGTGG + Intergenic
1138246069 16:55468093-55468115 CACCAGGACATCAGTGAGGAAGG - Intronic
1139511197 16:67429646-67429668 AGGCAGGACTTGAATGAGGAGGG - Intergenic
1139692265 16:68648772-68648794 AAGCAGGGCCTGAGTGGAGAGGG + Intronic
1140207498 16:72945784-72945806 AGGCAGGACGGGAGGGAGGAAGG + Intronic
1140896087 16:79325499-79325521 AAGCAGGATTTGAATGTGGATGG + Intergenic
1141534576 16:84670231-84670253 AAGCAGGGCCTGAGTGGCCATGG + Intergenic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1142058368 16:88014681-88014703 ATGCAGGACCAGTGCGAGGATGG - Intronic
1142291456 16:89195293-89195315 GGGCAGAACCTGAGTGTGGATGG + Exonic
1143307758 17:5961105-5961127 AAGAAGGATTTGGGTGAGGAAGG - Intronic
1143414461 17:6735922-6735944 AAGCCAGACCGGTGTGAGGAGGG + Intergenic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144055931 17:11540481-11540503 AAACTGGGCCTGAGTGATGAAGG - Intronic
1144653601 17:17021732-17021754 AGGCAGGACCTTGGTGAAGAGGG + Intergenic
1144673582 17:17146731-17146753 AAGCAGGAAGGGAGTGAGGATGG - Intronic
1145756026 17:27390589-27390611 AGGCAGGATGGGAGTGAGGATGG - Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145898630 17:28475341-28475363 AGACAGGACCAGAGTCAGGATGG - Intronic
1146017656 17:29246882-29246904 CAGCAGGAGCTGGGTGAGTAAGG + Exonic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1146956768 17:36940548-36940570 AAGCGGGTCCTGGGGGAGGAAGG + Intronic
1147181795 17:38691179-38691201 AGGCAGGACCTGGAAGAGGAAGG + Intergenic
1147636265 17:41966505-41966527 TAGCAGGAAGTGAGTGAGGCAGG - Intergenic
1148451551 17:47781312-47781334 AAGCGGGACCTGAGGAAGGCTGG + Intergenic
1148462955 17:47848537-47848559 GAGGAGGACCTGGGTTAGGAGGG - Intronic
1148526164 17:48338048-48338070 AAGAAGGAACTAAGTGAAGAAGG - Intronic
1148679746 17:49466750-49466772 AACCAGGATCTGAGAGAGGCTGG + Intronic
1150745142 17:67810709-67810731 AGGCAGGAACTGAGTCAGGTAGG - Intergenic
1151604185 17:75125874-75125896 AAGCAGCACCTGGGTCAGGCTGG - Intronic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151897670 17:76991258-76991280 AAGCAGGAGCTGGGCCAGGAAGG - Intergenic
1152234922 17:79133626-79133648 CAGCAGGACTTGAGCAAGGATGG - Intronic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152671781 17:81612318-81612340 AGGCAGGATCTAAGTGATGATGG + Intronic
1152779453 17:82219828-82219850 AGGCAGGACTGGAGTGTGGAAGG - Intergenic
1153181085 18:2434663-2434685 AACCAGCAACTAAGTGAGGAGGG - Intergenic
1154032749 18:10767683-10767705 GAGCAGGGCCTGTGTGAGGGTGG + Intronic
1155393731 18:25364468-25364490 TAGCACGAGCTGAGTGAGGCAGG - Intergenic
1155711730 18:28888865-28888887 AAGCATGAGCTGAGTTAGAAGGG + Intergenic
1156596996 18:38559066-38559088 AAGCAGGACCTCACTGCAGAGGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157558202 18:48627397-48627419 AGGCAGGAAGTGAGTGGGGAAGG + Intronic
1157575960 18:48743281-48743303 TTGCACGACGTGAGTGAGGAGGG - Intronic
1158679841 18:59557347-59557369 AAGCAGAAACTGAGTGATGAGGG - Intronic
1160004791 18:75061787-75061809 GAGCAGGACGAGAGTGAGGAGGG - Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160682858 19:419860-419882 GAGCAGCTCCTGAGTGAGGCTGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161723232 19:5914988-5915010 AAGCTGGACCGCAGTGGGGACGG + Exonic
1162138517 19:8571158-8571180 TCGCAGGACCTGGGTGAGGAAGG - Intronic
1163018188 19:14469605-14469627 AAGCAAGGCCTGAGGGTGGAGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163803726 19:19383977-19383999 AAGCAGCATCTGAGTGTGGGAGG - Intergenic
1164702326 19:30294750-30294772 AAGCAGGAGTTGAGTTTGGAGGG - Intronic
1164843153 19:31409730-31409752 AAGCAGGACATGGCAGAGGAAGG - Intergenic
1165308656 19:35017696-35017718 AAGGAGGAACTGAGGAAGGAAGG - Intronic
1166441549 19:42819691-42819713 AAGGAATACCTGAGTGAGGCTGG - Intronic
1166460982 19:42987983-42988005 AAGGAATACCTGAGTGAGGCTGG - Intronic
1166478271 19:43147963-43147985 AAGGAATACCTGAGTGAGGCTGG - Intronic
1167427443 19:49436748-49436770 ACGCTGGAGCTGAGTGCGGATGG - Exonic
1168246777 19:55116566-55116588 AAGCAGGACCTGCCTGGGAAGGG + Intronic
1168289095 19:55348289-55348311 AAGCACAGCCTGAGTGGGGATGG - Intergenic
1168422712 19:56215564-56215586 AACCAGGAGCTCAGTGAGGATGG - Intergenic
925214215 2:2079934-2079956 AAACAGTAACTGAGAGAGGATGG + Intronic
925697135 2:6592545-6592567 ATGTATGACCTGAGTGAGGGAGG + Intergenic
926069983 2:9879620-9879642 AAGCAAGAGCTGTGTGATGAAGG + Intronic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
926803986 2:16687795-16687817 AGGCAGGGTCTCAGTGAGGACGG - Intergenic
927022208 2:19029021-19029043 AAGCAAGCCCTGACTGTGGAGGG - Intergenic
927577676 2:24213162-24213184 AAGCAGGGCCTGAGTCTTGAGGG - Intronic
927606273 2:24490195-24490217 CAGCAGGACAGGATTGAGGAAGG + Intergenic
927778568 2:25921190-25921212 AAGCAGGTCCGCTGTGAGGATGG + Intergenic
927940828 2:27101836-27101858 ACCCAGGACCTGAATGGGGATGG - Exonic
928916896 2:36481822-36481844 AAGCAGGGCATGAGTTAGGCTGG - Intronic
929400969 2:41581102-41581124 TAGCTGGACCTGTGTGAAGATGG - Intergenic
930028725 2:47045429-47045451 AGGCAGGACCTCAGCGGGGATGG - Intronic
930322218 2:49870032-49870054 ATTCCAGACCTGAGTGAGGATGG + Intergenic
931236106 2:60413713-60413735 CACCAGGACCTGAGTGTGCATGG - Intergenic
933759768 2:85665467-85665489 AGGCAGGGCCTAAGGGAGGAGGG - Intronic
934018375 2:87915928-87915950 AAGAAGGAAGTGAGGGAGGAAGG + Intergenic
935333313 2:101993430-101993452 AAGAAGGTCATGAGTGAGGAAGG + Intronic
935556399 2:104513976-104513998 AAGGAGGACATGAGTTTGGAAGG + Intergenic
937437907 2:121894527-121894549 TTTAAGGACCTGAGTGAGGAAGG + Intergenic
938125426 2:128667552-128667574 AAGCAGGGCATGAGCAAGGACGG + Intergenic
938617298 2:133012687-133012709 AAGTAGGAACTGAGATAGGAAGG - Intronic
938672677 2:133600767-133600789 AAGCAGAGCCTGAGCGGGGATGG - Intergenic
939597179 2:144139666-144139688 AGGCAGGAGATAAGTGAGGAAGG + Intronic
939642706 2:144660181-144660203 AAGCAGCACAAGAGAGAGGAAGG - Intergenic
940106412 2:150105942-150105964 AAGCAGGAGGTGATTTAGGAAGG - Intergenic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941686691 2:168455722-168455744 AATCAGGAACTGAGGCAGGATGG - Intergenic
946112979 2:217436504-217436526 CAGCATGGCCTGAGTGAGGGCGG + Intronic
946267682 2:218561808-218561830 AAGCAGGGCCTGAGTCCTGAAGG - Intronic
946644491 2:221818316-221818338 AAGCAGGACCCTAGGGAAGAGGG - Intergenic
946712363 2:222519319-222519341 AAGCAGCTCCTGGGTGAGGCTGG + Intronic
948313712 2:237010549-237010571 AATCAGTAACTGAGTAAGGAAGG - Intergenic
948889475 2:240900033-240900055 AAGCAGGGGCTGGGGGAGGAAGG + Intergenic
948981505 2:241497090-241497112 AGGCAGGGCCTGCCTGAGGACGG - Intronic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1170357363 20:15507307-15507329 AAGCAGGAAGGGAGGGAGGAAGG - Intronic
1172857167 20:38014140-38014162 AGGCAAGACTTGAGGGAGGAAGG + Intronic
1172970621 20:38870723-38870745 AAGCAGGACCGGAGACATGAAGG + Intronic
1173134404 20:40426453-40426475 AAGCAAGAGATGGGTGAGGAGGG - Intergenic
1173187508 20:40852034-40852056 AAGAAGGACTTGAGAGAGAAAGG + Intergenic
1174115324 20:48222998-48223020 AAGCAGGAGGTCAGTGAGGAGGG + Intergenic
1174863318 20:54112691-54112713 AAGCACCACCTCAGAGAGGAGGG - Intergenic
1175286494 20:57840288-57840310 GAGCTGGACCTGAGAGCGGACGG + Intergenic
1175400961 20:58699628-58699650 AGGCAGGGCCTGTGTGCGGATGG + Intronic
1176017937 20:62946350-62946372 ATGCAGGAGCTCGGTGAGGACGG - Exonic
1176842157 21:13850101-13850123 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1176988195 21:15462323-15462345 CAGTAGGTCCTGAGTGGGGAGGG - Intergenic
1177031243 21:15983767-15983789 AAGCCAGACCGGTGTGAGGAGGG + Intergenic
1177894854 21:26845849-26845871 AAGAGGGAACTGAGGGAGGAGGG - Intergenic
1178771699 21:35510786-35510808 AAACAGGACCTCGGTGAGCATGG + Intronic
1179238090 21:39564878-39564900 AAGCAATACCTGCCTGAGGAAGG - Intronic
1179339176 21:40488250-40488272 AAGCAGAAACTCAGAGAGGAAGG - Intronic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1181472303 22:23148170-23148192 AAGAAGGAACTTAGGGAGGAAGG - Intronic
1181694521 22:24586189-24586211 GAGCAGGAGCTGGGTGAGGCGGG + Exonic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1184047757 22:41982083-41982105 AAGCAGGATCAGAGTGGTGAAGG - Intronic
1184069959 22:42141491-42141513 AGGCAGGGACTGAGGGAGGAAGG - Intergenic
1184907375 22:47497892-47497914 GGGCAGGGCCTGAGTGGGGAGGG + Intergenic
1185018986 22:48362575-48362597 AGCCAGGAGCTGTGTGAGGAGGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
949505499 3:4724065-4724087 AGGAAGGACATGAGTGGGGAAGG - Intronic
949731927 3:7123677-7123699 AAGCAGGGAGTGAGTGAGGAAGG - Intronic
949964182 3:9341339-9341361 AAGGAGCACTTGAGTGTGGAGGG - Intronic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
951923991 3:27887214-27887236 TAGAAGGACCTGAGTGTGTAAGG - Intergenic
952333694 3:32387021-32387043 CCACAGGAGCTGAGTGAGGAAGG - Intergenic
952660016 3:35834132-35834154 AAGAAAGCCCCGAGTGAGGAGGG - Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953169613 3:40495425-40495447 AAGAAGGAGAGGAGTGAGGAGGG - Intergenic
953847390 3:46438575-46438597 GAGCAGGAACTGTGTGAGGGAGG - Intronic
954115579 3:48465363-48465385 GAGCAGGGCCTGGGTGTGGAAGG + Intronic
954137914 3:48590616-48590638 AACCAGGACCAGAGTGAGGCAGG + Intronic
954411656 3:50373824-50373846 AAGTGGGAACTGAGTGAGGATGG + Intronic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
957538406 3:81535959-81535981 AAGCTGGGGCTGAGTGAGGGTGG - Intronic
957989893 3:87614496-87614518 GAGGAGGAATTGAGTGAGGAGGG + Intergenic
958970473 3:100605522-100605544 GAGCCGGAGCTGAGTGGGGAGGG - Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
962345274 3:134614179-134614201 AGGCAGGAGCTGAGAGAGCACGG + Intronic
963604915 3:147405723-147405745 AGGCAGGACCAGGGTGAGGGAGG + Intronic
963836892 3:150067258-150067280 AAGCAGTACCTGGATGAGAACGG - Intergenic
964245040 3:154642094-154642116 AAGCTGTAGCTAAGTGAGGAGGG - Intergenic
964818255 3:160740727-160740749 AAGCAGGACCTGCTTCAGGTGGG - Intergenic
967005438 3:185378506-185378528 AAGCCAGACCGGTGTGAGGAGGG + Intronic
968187544 3:196643610-196643632 AAGCAGGACCTAAGTGTCTAAGG + Intronic
968350121 3:198046658-198046680 AAGCAGGACCTGGGAGCAGAGGG + Intergenic
968479961 4:828904-828926 GGGCAGGAGCTGAGTGAGAAAGG + Intergenic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
969570844 4:8007351-8007373 AAGCAGGGGCTGGGAGAGGATGG - Intronic
969660204 4:8523001-8523023 AAGCAGGAGGTGGGAGAGGATGG - Intergenic
970321467 4:14879627-14879649 AAGCAGGATCTTAGGGAAGATGG - Intergenic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
973339911 4:48993416-48993438 TAACAGGATCAGAGTGAGGAGGG - Intronic
973394025 4:49578653-49578675 AAGCGGGACCTGGGAGAAGAGGG - Intergenic
974134971 4:57803940-57803962 GAGCTGGGCATGAGTGAGGAGGG + Intergenic
974368968 4:60989117-60989139 AAGCAGGGCCTGGGTGAGGATGG - Intergenic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
979541802 4:121892075-121892097 AAGCAGGAGCTGGGAGAGGAAGG + Intronic
979579909 4:122345579-122345601 AAATAGGACCTGATTGTGGAGGG + Intronic
980277250 4:130669832-130669854 AAGAAGGACTTTAGGGAGGATGG - Intergenic
981635848 4:146878109-146878131 AAGCAGGAATGAAGTGAGGATGG + Intronic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
985215485 4:187649158-187649180 AAGCTGCACCTGAGTGAGTGAGG - Intergenic
985581444 5:697459-697481 ACGGAGGACCAGAGAGAGGATGG + Intergenic
985879639 5:2628570-2628592 GAGCAGGAGCTGAGTGGGCAGGG - Intergenic
985954080 5:3249195-3249217 AGACAGGACATGACTGAGGAAGG - Intergenic
986735018 5:10662092-10662114 AACCAGGACCTGGGAGAGGCAGG + Intergenic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987109692 5:14673978-14674000 AATCAAGAACTGAGAGAGGACGG - Intronic
987756536 5:22104459-22104481 AAGAAAGACCTGAGTGTGAAAGG + Intronic
988272118 5:29031048-29031070 AAGCAGGAACTGTGGGAGGCAGG + Intergenic
988635008 5:32973712-32973734 AAGCAAAAACTGAGTGGGGAGGG - Intergenic
990104697 5:52244537-52244559 AAGGATCACCTGAGTGAGGCAGG - Intergenic
991728316 5:69559256-69559278 AGCCATGACCTGAATGAGGAAGG - Intergenic
991804745 5:70414403-70414425 AGCCATGACCTGAATGAGGAAGG - Intergenic
991866639 5:71068619-71068641 AGCCATGACCTGAATGAGGAAGG + Intergenic
995695459 5:114874117-114874139 AAACAGAACCTCAGTGTGGATGG + Intergenic
996004917 5:118407962-118407984 AAGCAGGATCTGTGAGATGATGG - Intergenic
996552289 5:124743705-124743727 AAGCAGGACAAGAGTCAAGAGGG + Intronic
999279278 5:150354356-150354378 AAGCAGGAACAAAGAGAGGATGG - Intergenic
999625605 5:153517336-153517358 AAGCAAGCCCTGGGGGAGGAGGG - Intronic
999795602 5:154986925-154986947 AAACATGACCTAAGTGAGGTGGG + Intergenic
1001299694 5:170524743-170524765 AAACAGGTCCTGAGAGAGGAGGG + Intronic
1001446594 5:171789775-171789797 AGGCAGGGCAGGAGTGAGGATGG + Intronic
1001702049 5:173713802-173713824 CAGCAGGACCTGTGTGACGTGGG - Intergenic
1002077001 5:176714250-176714272 AAGGAGGAGATGAGTCAGGAAGG - Intergenic
1002137515 5:177117071-177117093 AAGCCCGACCTGAGTGCGGCAGG + Intergenic
1002713016 5:181206154-181206176 AAACAAGACCTGAATGAGGTGGG - Intergenic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1003511463 6:6784693-6784715 AAGCAGGGACTGCGTGAGAATGG - Intergenic
1006054997 6:31377675-31377697 CAGCAGGCCTTGAGTGAGGGAGG - Intergenic
1006452360 6:34112550-34112572 GAGAAGGGCCTGAGTGTGGAAGG + Intronic
1006514284 6:34537500-34537522 ATGCAGGACCGGAGTGGGGAAGG - Intergenic
1006834766 6:36991195-36991217 AAGGAAGACCAGAGTGAGGCTGG - Intergenic
1007688802 6:43684443-43684465 AAGCAGGGCTTGAGGCAGGAAGG - Intronic
1013967103 6:115967971-115967993 ATTCCAGACCTGAGTGAGGATGG - Intronic
1014103816 6:117540904-117540926 AATCATTACCTGAGAGAGGAGGG - Exonic
1015254649 6:131164400-131164422 GAGCAGGTGCTGAGAGAGGAAGG + Intronic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1017204451 6:151789991-151790013 AATGAGGCCCTGAGTGAGGGGGG - Intronic
1017972649 6:159326732-159326754 AAGCAGGAGCTTAGTGGGAAAGG + Intergenic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1018347745 6:162920188-162920210 AAGGAGGAAGTGAGGGAGGAAGG + Intronic
1018890031 6:167976703-167976725 GAGCAGGACCTGAACCAGGAAGG - Intergenic
1020219759 7:6226733-6226755 CAGCAGAACCTGAGCAAGGAAGG + Intronic
1021253228 7:18357746-18357768 GAGAAGGCCCTGAGTCAGGAAGG + Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1022077670 7:26989031-26989053 AAGAATGACCTGAGTGAATAGGG - Intronic
1022337891 7:29439549-29439571 GAAGAGGGCCTGAGTGAGGATGG - Intronic
1022897052 7:34761098-34761120 AAGCAGGAGGTAAGGGAGGAAGG - Intronic
1023081974 7:36534341-36534363 CAGCTGGACCTGATTGAGAATGG + Intronic
1023622945 7:42091339-42091361 AGGCAGGGCCTGGGTGAGGTAGG - Intronic
1025232906 7:57214629-57214651 TACCAGGGCCTGAGGGAGGATGG + Intergenic
1027052675 7:75029767-75029789 AGGCAGAGCCTGAGTGAGGCCGG + Intronic
1028178816 7:87691794-87691816 AGGCAGGACCTGACTGATGGAGG - Intronic
1028513605 7:91651809-91651831 AAGTAGGACCTGAGTGCTGGAGG - Intergenic
1034917941 7:155056376-155056398 AAGCAAGCCCTGAGGCAGGAGGG - Intergenic
1036616195 8:10389667-10389689 AGGCAGGACTGGAGAGAGGATGG - Intronic
1037957044 8:23068350-23068372 AGGCAGGAACTGAGCGAGGAAGG + Intronic
1038493731 8:27987503-27987525 AAGCTGAACCTGTGTGAGGATGG - Exonic
1038705850 8:29893123-29893145 AAGCAGGACCTGGCTGGGCATGG - Intergenic
1039566143 8:38553875-38553897 AAGCAGGAACAGAGGGAGGGGGG + Intergenic
1039902285 8:41761842-41761864 GGGCAGCACCTGAGTGTGGAGGG - Intronic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1047031889 8:120890975-120890997 AAGAAGGAAGTGAGTGAGCAAGG - Intergenic
1048729721 8:137424891-137424913 ACCCACGACCTAAGTGAGGATGG - Intergenic
1048927567 8:139284424-139284446 AATCAGGAACGGAGTGAGGTTGG - Intergenic
1049179309 8:141212899-141212921 CAGCAGGGGCTGAGTGGGGAGGG + Intronic
1049527305 8:143133888-143133910 AGGCAGGACGTGTGGGAGGATGG - Intergenic
1049542459 8:143214761-143214783 TCGCAGGACGTGAGTGATGATGG + Intergenic
1050718446 9:8557064-8557086 AAGGAGGACCAGTGAGAGGAAGG + Intronic
1051366598 9:16325671-16325693 AAGAAGGACTTGAGTGCCGAGGG - Intergenic
1051818154 9:21133860-21133882 AAGGAGGCTCTGACTGAGGAAGG - Intergenic
1051854781 9:21551578-21551600 AAGCAGTACCTGGGTTAAGAGGG - Intergenic
1051857474 9:21585494-21585516 AAGGAGGAGCTGTGTGAAGATGG + Intergenic
1053065003 9:35061955-35061977 AAGTAGGACCTAAGCAAGGACGG + Intronic
1054896980 9:70324945-70324967 AACCAGGAGATGTGTGAGGAGGG - Intronic
1056770815 9:89476804-89476826 GAGCAGAACCTGACTGCGGAAGG + Intronic
1056838176 9:89974848-89974870 AAGCAGGAAGTAAGGGAGGAAGG + Intergenic
1057268884 9:93636109-93636131 ACTCAGGGCCTGAATGAGGAGGG + Intronic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057694643 9:97314545-97314567 AAGCAGGACCTGGGTGGGGCAGG - Intronic
1058366044 9:104209590-104209612 TAGCAGGACCCGTGGGAGGAAGG + Intergenic
1058556512 9:106174378-106174400 AAGCAGGACATGAGTAGTGAGGG - Intergenic
1059404573 9:114092041-114092063 CAGATGGACCTGGGTGAGGAAGG - Intronic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1059740133 9:117141977-117141999 AAGCAGGATCAGGGTGAGGTTGG + Intronic
1060147424 9:121265005-121265027 AAGCAGGACCTGAGTACTAAAGG - Intronic
1060277598 9:122193741-122193763 AACCAGGTCCTGAAGGAGGAAGG + Intronic
1060512217 9:124242421-124242443 AAGCGGGACACGATTGAGGAGGG + Intergenic
1061055441 9:128220014-128220036 AAGCTGGACCTGATGGACGAGGG + Exonic
1061399037 9:130358396-130358418 AAGGTGGACCTGAGGGACGAGGG + Intronic
1061804868 9:133132286-133132308 AGGCAGGATCTGGGTGAGGCAGG + Intronic
1061958844 9:133977823-133977845 GGGCAGCACCTGAGTCAGGAAGG + Intronic
1062118849 9:134823123-134823145 CAGCAGGGCCTGAGCTAGGACGG - Intronic
1062388349 9:136324143-136324165 AAGCAGGCCGGGAGTGGGGAGGG - Intergenic
1062468904 9:136693644-136693666 GGGCAGGACCTGGGTGAGGAGGG + Intergenic
1062540240 9:137038845-137038867 AAGAAGGCCCCGAGGGAGGAAGG - Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185554850 X:1013107-1013129 CAGCGGGACGTGAGTGTGGATGG + Intergenic
1185644703 X:1608640-1608662 AGGCATGAGCTGAGTGAGGTGGG - Intergenic
1186188353 X:7043545-7043567 AAGGAATACCTGAGTGAGGCTGG - Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1188025389 X:25202935-25202957 AAGCAGGTCCTTAGTAAGGCTGG - Intergenic
1188291602 X:28395774-28395796 ATGCAGGTCCTTAATGAGGATGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189211779 X:39289965-39289987 AAGCAGGCTCTGTGTGTGGAGGG + Intergenic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1190385090 X:49877789-49877811 AAGCAAGAGCTGACTCAGGAAGG + Intergenic
1191884834 X:65877773-65877795 AGGCAGGTCCTGGGTTAGGATGG + Intergenic
1193377103 X:80774471-80774493 ACTCAGGAACTGTGTGAGGATGG - Intronic
1195952807 X:110294297-110294319 AAGCTGTACATGATTGAGGAAGG - Intronic
1196016367 X:110944512-110944534 GAGCAGGAACTGGGGGAGGAAGG - Intronic
1196130141 X:112146625-112146647 AAGCAGGAGGTCAGTGAGGTAGG + Intergenic
1197294290 X:124698699-124698721 AAGCAGGAGCTGATTATGGAAGG - Intronic
1198323215 X:135540658-135540680 AATCAAGACCTGAATTAGGATGG - Intronic
1198634137 X:138676803-138676825 CAGCAGGACCTGAGCGATGGGGG - Intronic
1199126158 X:144123210-144123232 AAGAAGGAAGTGAGGGAGGAAGG - Intergenic
1199706008 X:150426030-150426052 AAGCAGGACCTGAAACAGAAAGG - Intronic
1200078987 X:153566279-153566301 TGGCAGGACCTCAGGGAGGAGGG - Intronic