ID: 1081655398

View in Genome Browser
Species Human (GRCh38)
Location 11:44853850-44853872
Sequence GCCTCCCGGTTCTGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081655392_1081655398 -9 Left 1081655392 11:44853836-44853858 CCGCAGCCCTCTGGGCCTCCCGG 0: 1
1: 0
2: 7
3: 62
4: 646
Right 1081655398 11:44853850-44853872 GCCTCCCGGTTCTGTGTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1081655389_1081655398 5 Left 1081655389 11:44853822-44853844 CCTCGGGGAGGAGGCCGCAGCCC 0: 1
1: 0
2: 0
3: 37
4: 369
Right 1081655398 11:44853850-44853872 GCCTCCCGGTTCTGTGTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1081655383_1081655398 24 Left 1081655383 11:44853803-44853825 CCGGAGTGCAGAAGCAGCACCTC 0: 1
1: 0
2: 0
3: 22
4: 364
Right 1081655398 11:44853850-44853872 GCCTCCCGGTTCTGTGTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081655398 Original CRISPR GCCTCCCGGTTCTGTGTGGT GGG Intronic
902408439 1:16199229-16199251 GCCCCCAGGTTCAGTGTGTTAGG - Exonic
904163515 1:28538044-28538066 GCTTCCCTGTTCTGTGAGGGAGG - Exonic
906004426 1:42456601-42456623 GCCTCCCGGTGCTGCGCGCTGGG + Exonic
907764874 1:57399148-57399170 GCCTTTTGGTTCTGTGTGGCTGG - Intronic
910103165 1:83600021-83600043 GACTCCCAGTTCTGTGTGGCTGG + Intergenic
912511951 1:110195567-110195589 GCCTCCCGGCTCTCTGTAGTGGG + Exonic
912518675 1:110231053-110231075 GCCTCCCAGTTCTGTGGGAAGGG - Intronic
912519555 1:110235674-110235696 GCCTGCTGTTTCTGTGAGGTGGG - Intronic
913091606 1:115479966-115479988 GACTCACAGTTCTGTGTGGCTGG + Intergenic
915357122 1:155262021-155262043 TCTTCCCGGTTCTGTAGGGTCGG - Intronic
915859698 1:159431090-159431112 GTCTCCCCGTTCCGTGTGGAGGG - Intergenic
922371151 1:224911501-224911523 GACTCACAGTTCTGTGTGGCTGG + Intronic
922911705 1:229223519-229223541 GCCTCTCGGTTCTGTGACCTGGG - Intergenic
1063138743 10:3238658-3238680 TCCTCTGGGGTCTGTGTGGTCGG - Intergenic
1063179559 10:3585521-3585543 GCCTCGCTGCTCTGTGTGGACGG - Intergenic
1063358015 10:5420551-5420573 ACCTCCCAGTTCTGGGTAGTAGG + Intronic
1063507485 10:6613972-6613994 GACTCACAGTTCTGTGTGGCTGG - Intergenic
1068196018 10:53717290-53717312 GCCTCCCTGTTATGCTTGGTTGG - Intergenic
1071794722 10:88991758-88991780 GGCGCCGGGTTCTGTGCGGTGGG - Intronic
1074606154 10:114969759-114969781 GCCTCCCCCTTCTCTGTTGTTGG - Intronic
1074960054 10:118436133-118436155 GACTCACAGTTCCGTGTGGTTGG - Intergenic
1076796244 10:132799760-132799782 GACTCACGGTTCTGTGTGGCTGG + Intergenic
1076871039 10:133195303-133195325 GGCTCCCGGGTCCGTGAGGTGGG + Intronic
1077212392 11:1377553-1377575 TCCTCACGGTGCTGTGTGGTGGG - Intergenic
1078136686 11:8657727-8657749 GCCTTCAGGGGCTGTGTGGTGGG - Intronic
1078593615 11:12667500-12667522 GTCTCACGGTTCTGTGGGCTGGG + Intergenic
1078680107 11:13467838-13467860 GCCTCCTGGTTATGTTGGGTAGG - Intergenic
1081655398 11:44853850-44853872 GCCTCCCGGTTCTGTGTGGTGGG + Intronic
1083899943 11:65638663-65638685 GCCTTCCGGATCTGTGGGGGCGG + Intronic
1088917188 11:114236512-114236534 GCCCCCCGTGTCTGTCTGGTGGG - Intronic
1096522435 12:52191877-52191899 GCCTGCCGCTCCTGCGTGGTTGG - Exonic
1097395972 12:59075261-59075283 GCCTGCCAGGTCTGTGTGCTTGG - Intergenic
1099568247 12:84279772-84279794 GACTCACAGTTCTGTGTGGCTGG + Intergenic
1101350908 12:103929536-103929558 GCCGCCCGGTTCTGGGGGGTCGG - Intergenic
1102017990 12:109661111-109661133 CCATCCTGGCTCTGTGTGGTGGG - Intergenic
1102925546 12:116823255-116823277 GCCTCAGTGTTCTGTGTGATGGG - Intronic
1103454298 12:121052891-121052913 GCCTCACCTTTCTGTGTGGCTGG - Intergenic
1104615944 12:130268604-130268626 GTCAGACGGTTCTGTGTGGTGGG - Intergenic
1104983156 12:132582861-132582883 GCCTCCAGTTTCTGGGTGGCCGG - Intronic
1106347060 13:28889186-28889208 TGCTCCTGGTTCTGTGTGGCAGG + Intronic
1112307150 13:98285258-98285280 GCCTCCAGGTTATGGGGGGTGGG - Intronic
1113515017 13:110887755-110887777 GCCTCTAGGTGCTGTGTGGAAGG + Intronic
1114780301 14:25532027-25532049 GACTCACAGTTCTGTGTGGCTGG + Intergenic
1116493457 14:45533890-45533912 GACTCACAGTTCTGTGTGGCTGG + Intergenic
1119807099 14:77489298-77489320 GCAGCCTGGCTCTGTGTGGTTGG - Intronic
1121328244 14:93034183-93034205 ACCTCCCAGTTCAGTGTGCTGGG - Intronic
1121632009 14:95428124-95428146 GCCTCCTCTTTCTGTGAGGTGGG - Intronic
1122778074 14:104131590-104131612 GCCTCGAGGTGCAGTGTGGTGGG + Intergenic
1123764758 15:23466861-23466883 GCCTCCCGGGTTTGGGTGGCTGG + Intergenic
1124037247 15:26065949-26065971 GACTCCAGGTTCAGTGTGGTTGG - Intergenic
1129113652 15:73352841-73352863 TCCTCCTGGGTCTGTCTGGTTGG - Intronic
1130666497 15:85873941-85873963 GCCTCCCGGTTGTGCGGTGTTGG + Intergenic
1132567381 16:629767-629789 GCCTCCCTGTGCTGTTTCGTGGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1133345911 16:5070344-5070366 GCCTCCAGGTTGCGTGTGCTGGG - Intronic
1137002378 16:35240576-35240598 TGCTTCAGGTTCTGTGTGGTTGG - Intergenic
1138346298 16:56322378-56322400 GCCTATGGGTTGTGTGTGGTGGG - Intronic
1140935989 16:79670749-79670771 GACTCACAGTTCTGTGTGGCTGG + Intergenic
1142420988 16:89969876-89969898 GCCTCCCTGCTCTGTGGTGTTGG - Exonic
1142508050 17:378212-378234 GCCTCCCGGGTCTGTGGTGCCGG - Intronic
1142718824 17:1762964-1762986 GCCCCCAGGTTCCGTGGGGTTGG + Intronic
1144061855 17:11590108-11590130 CCCTCCCCATTCTGTGTGATTGG - Intergenic
1144614525 17:16757103-16757125 GCCTCCAGGTGGTGTGTGCTGGG + Intronic
1144898180 17:18558571-18558593 GCCTCCAGGTGGTGTGTGCTGGG - Intergenic
1145134190 17:20387143-20387165 GCCTCCAGGTGGTGTGTGCTGGG + Intergenic
1149236650 17:54598805-54598827 GACTCACAGTTCTGTGTGGCTGG - Intergenic
1150331132 17:64295164-64295186 GCCTCCCGGCTCTGAGTTTTTGG + Intergenic
1151561450 17:74872079-74872101 ACCCCCCAGATCTGTGTGGTGGG - Exonic
1152618595 17:81349535-81349557 GCCTCCGGGTTCTGGGATGTGGG - Intergenic
1152928532 17:83098843-83098865 GCCTCCCAGTGCGGTGGGGTGGG - Intergenic
1154367628 18:13726136-13726158 GCCGCCGGGGTCTGTGGGGTCGG + Intronic
1158629046 18:59096179-59096201 GCCTCCTGGTTCTCTGTGCCAGG - Intergenic
1159917097 18:74197766-74197788 GCCTCCTGTTTCTGTGAAGTGGG + Intergenic
1159919428 18:74214356-74214378 GCCACCCGGTGGGGTGTGGTGGG + Intergenic
1159943775 18:74428655-74428677 GCTCCCAGGTTCTGTGTGGAGGG - Intergenic
1162535850 19:11262494-11262516 GCCTCCCGGTTCTGGGCAGCCGG + Intergenic
1163160558 19:15461556-15461578 GCCTCAGGGATCTGTGGGGTAGG + Exonic
1164899521 19:31906721-31906743 GCCTCCTGGCTCTGTCTGGGTGG + Intergenic
1165031435 19:33000562-33000584 GCCAGGAGGTTCTGTGTGGTGGG - Intronic
1165305208 19:34999441-34999463 GACTCGCATTTCTGTGTGGTTGG + Intronic
1166374834 19:42321901-42321923 GCTTCCCCGCTCTGTGTAGTGGG - Intronic
1167215963 19:48164839-48164861 GCCTGATGGTTCTGTGTTGTTGG + Intronic
1168321343 19:55511834-55511856 GCCTCCAGGATCAGTGTGGGGGG + Intronic
925100748 2:1243351-1243373 GCCTCCCAGGTCTGGGTGCTCGG + Intronic
925454061 2:3999024-3999046 GACTCACAGTTCTGTGTGGCTGG - Intergenic
927397629 2:22672215-22672237 GCCTCCAGGCTCTGTTGGGTTGG + Intergenic
927851728 2:26503835-26503857 TCCTCCCGGCTCTGTGAGGGGGG + Exonic
931951933 2:67373736-67373758 GCATGACGGTTCTGTCTGGTGGG - Intergenic
932831768 2:74996968-74996990 GACTCCCAGTGCTGTGCGGTGGG - Intergenic
933055295 2:77655610-77655632 GACTCACAGTTCTGTGTGGCTGG - Intergenic
934534480 2:95121741-95121763 GCCTCCCCGTGCTGTGTAGCGGG - Exonic
935313349 2:101806954-101806976 CCCTGGCGATTCTGTGTGGTTGG + Intronic
944662752 2:201934913-201934935 GACTCACAGTTCTGTGTGGCTGG + Intergenic
946165276 2:217859764-217859786 GGCTCTCGGATCTGGGTGGTTGG - Intronic
946747674 2:222861570-222861592 GCCTCCCGGCGCTGTGGGGCGGG + Intronic
947491063 2:230594533-230594555 GCCTGCTGGTTCTCTGTGCTTGG - Intergenic
948662121 2:239514139-239514161 GCCTCCAGGTCCTGTGTTGGGGG - Intergenic
948803968 2:240445204-240445226 GCCTCCCTGTTCTATGTGCGTGG + Intronic
1168835453 20:874400-874422 GCCTCCAGGCTTTCTGTGGTCGG - Exonic
1168961280 20:1871623-1871645 GCCTCCTGGTTCTCTGGGGAGGG - Intergenic
1173072164 20:39778883-39778905 GCCTCCCTCTTCTGTGAGGTGGG - Intergenic
1177619222 21:23565127-23565149 GACTCACAGTTCTGTGTGGTTGG - Intergenic
1179571246 21:42280075-42280097 GCCTCCAGGTCCTGTGGGGAGGG - Intronic
1179608815 21:42535734-42535756 GCCTCGAGGTCCTGTGTTGTGGG - Intronic
1183366740 22:37410907-37410929 GAGTCCCGGTTCTGGGTGCTAGG - Intronic
1184439461 22:44499953-44499975 GACTTACAGTTCTGTGTGGTGGG - Intergenic
1184742097 22:46434478-46434500 CCCTCCGGGCTCTGTGAGGTGGG - Intronic
951085445 3:18507553-18507575 GTCTTCCAGTTCTGTTTGGTTGG - Intergenic
952156883 3:30653127-30653149 GCATCTCTTTTCTGTGTGGTGGG + Intronic
953752284 3:45618034-45618056 CCCTTCTGGTTCCGTGTGGTGGG + Intronic
953918331 3:46934988-46935010 GCCTCTCTGCTCTGTGTGCTGGG - Intronic
962204957 3:133426747-133426769 GCCTCCCTCTTCTGCGTGGGAGG + Intronic
966453200 3:180085723-180085745 GACTCACAGTTCTGTGTGGCGGG - Intergenic
967718029 3:192785683-192785705 GACTCACGGTTCTGCATGGTTGG - Intergenic
973605715 4:52585475-52585497 GAGTCACTGTTCTGTGTGGTGGG - Intergenic
976000102 4:80364245-80364267 GCCTCCATGTTCAGTTTGGTTGG + Intronic
978515212 4:109561209-109561231 GCCTTCAGGGTGTGTGTGGTTGG + Intronic
979848290 4:125544712-125544734 GACTCACAGTTCTGTGTGGCTGG - Intergenic
981862784 4:149378158-149378180 GACTCACAGTTCTGTGTGGCTGG - Intergenic
985655845 5:1131000-1131022 CCCTCCCTGTTCTGTGTCCTGGG - Intergenic
986858659 5:11902950-11902972 GCCTCCCTGGTGTTTGTGGTAGG - Intronic
992168393 5:74077266-74077288 GACTCACAGTTCTGTGTGGCTGG - Intergenic
992736954 5:79731333-79731355 TCATCTCGGTTGTGTGTGGTGGG - Exonic
994303682 5:98177739-98177761 GACTCCCAGTTCTGCATGGTTGG + Intergenic
994730009 5:103480951-103480973 GCCTCAAGGCTCTGTGTAGTTGG + Intergenic
999110512 5:149116342-149116364 CCCTCCCGGAGCTGTGTGCTTGG - Intergenic
999375398 5:151083033-151083055 GGCTCCCAGTCCTGTGTGCTTGG + Intronic
1000514104 5:162219008-162219030 GCCTCTCTGTTCTATGTGATGGG + Intergenic
1000889261 5:166784514-166784536 GCCTGCCAGTCCCGTGTGGTGGG + Intergenic
1006916969 6:37601025-37601047 GACTCACAGTTCTGTATGGTTGG + Intergenic
1008023955 6:46612638-46612660 GCCTCCCGAATCTCTGTGTTAGG + Intronic
1008613670 6:53206510-53206532 GCTTCCCTGTTCTGTGTGGAAGG + Intergenic
1024475972 7:49811524-49811546 GACTCACAGTTCTGTGTGGCTGG - Intronic
1025042853 7:55662905-55662927 GCCTCCAGGTAGTGTGTGCTGGG - Intergenic
1028840424 7:95423785-95423807 GACTCACTGTTCCGTGTGGTTGG + Intronic
1028961161 7:96751034-96751056 GACTCACGGTTCTGTGTGGCTGG + Intergenic
1029173000 7:98643921-98643943 GCCTCCCTGATCTGTGGGGCAGG - Intergenic
1031586144 7:123534393-123534415 GACTCTGGGTTCTGTGTGCTGGG - Intronic
1033589264 7:142796728-142796750 GACTCCTGGTTCTGGGTGCTGGG + Intergenic
1033722352 7:144074940-144074962 TCCTCCCACCTCTGTGTGGTTGG + Exonic
1033729206 7:144157947-144157969 TCCTCCCACCTCTGTGTGGTTGG + Intergenic
1034820663 7:154213567-154213589 GCCTCCCAGCTCTGTGTGCGAGG - Intronic
1035889027 8:3324215-3324237 CCCTCCCGGGTCTCTGGGGTTGG - Intronic
1036703392 8:11029089-11029111 CCCTCCCAGTCCTGTGTCGTAGG + Intronic
1037117176 8:15240662-15240684 GACTCACGGTTCTGCGTGGCTGG - Intergenic
1037387485 8:18358943-18358965 GCCTCCTGGTGCTGTCTAGTAGG - Intergenic
1039477637 8:37848715-37848737 GCGTCCTGGTTTTGTGTGGTGGG - Intronic
1045249449 8:100471173-100471195 GACTCACAGTTCTGTGTGGCTGG - Intergenic
1058176799 9:101745092-101745114 GCCTCCCGGTTTTGACTGGGAGG - Intergenic
1060596857 9:124853649-124853671 GGTTCCTGGTTCTGTGTAGTGGG + Intronic
1061060845 9:128249891-128249913 CCCTCCCGGTTCTGTGACCTTGG + Intronic
1062583192 9:137237214-137237236 CCCTCCCTCTGCTGTGTGGTCGG + Intergenic
1186197260 X:7121612-7121634 GCCTCCTTGTTCTCTGTGTTTGG - Intronic
1186460998 X:9748607-9748629 GCCACCCTGCTCTGTGTGGAGGG - Exonic
1187424451 X:19164442-19164464 GACTCACGGTTCCATGTGGTTGG + Intergenic
1188470535 X:30533561-30533583 GACTCACAGTTCTGTATGGTTGG + Intergenic
1188565325 X:31520449-31520471 GACTCACAGTTCTGTGTGGCTGG - Intronic
1189278750 X:39806091-39806113 GACTCACAGTTCTGTGTGGCTGG - Intergenic
1194786089 X:98086061-98086083 GACTCACAGTTCTGTATGGTTGG + Intergenic
1195308347 X:103607810-103607832 GCCTCCCGGTCCTTCGGGGTTGG + Intronic
1195891064 X:109695601-109695623 GCCTCCCGCTCCTGAGTAGTTGG - Intronic
1199439957 X:147856528-147856550 GACTCACAGTTCTGTGTGGTTGG - Intergenic
1200268723 X:154661367-154661389 GACTCACAGTTCTGTGTGGCTGG - Intergenic
1200777857 Y:7185721-7185743 GGCTCACTGTTCTGTGTGGCTGG - Intergenic
1201667471 Y:16474859-16474881 GACTCACAGTTCTGTGTGGCTGG + Intergenic