ID: 1081657271

View in Genome Browser
Species Human (GRCh38)
Location 11:44865797-44865819
Sequence GGTCTCAGTGGAGCAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081657267_1081657271 -4 Left 1081657267 11:44865778-44865800 CCTGAGGCTGGTGCCAAGGGGTC 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG 0: 1
1: 0
2: 1
3: 25
4: 250
1081657260_1081657271 20 Left 1081657260 11:44865754-44865776 CCAGTTGTCATCCAGGCTAAAAG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG 0: 1
1: 0
2: 1
3: 25
4: 250
1081657262_1081657271 9 Left 1081657262 11:44865765-44865787 CCAGGCTAAAAGTCCTGAGGCTG 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG 0: 1
1: 0
2: 1
3: 25
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081657271 Original CRISPR GGTCTCAGTGGAGCAGGAAC AGG Intronic
900127489 1:1075085-1075107 GGTCTCAGAGGAGCAGCCAGTGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900512600 1:3067697-3067719 GGTCTCAGTGGAGCCGCCACAGG + Intergenic
902561193 1:17278645-17278667 AGTCTCAGTGGGGCTGGAAAGGG - Intronic
902842507 1:19084217-19084239 GCTCACAGGGGAGCAGGAAGTGG - Intronic
903181295 1:21606208-21606230 GGTGGCAGTGGAGGAGGCACAGG + Intronic
904081668 1:27876327-27876349 GAACTCAGTGGAGGAGGCACGGG + Intronic
904117625 1:28174249-28174271 GGCAACAGTGGAGCAGGAGCCGG - Intronic
904935708 1:34128215-34128237 GGGCTAAGTGGAGCAGGCAGGGG - Intronic
906706269 1:47897111-47897133 GGAGAAAGTGGAGCAGGAACAGG + Intronic
908757087 1:67479171-67479193 GGTCTGAGTGGTGGAGGAACAGG - Intergenic
910654287 1:89604304-89604326 GGTCTCAGCTGAACAGAAACTGG - Intergenic
915007674 1:152655363-152655385 GTTCTGGGTGGAGCAGGAAGTGG - Intergenic
915732011 1:158060521-158060543 AGTCTCAGTGGAGGCGGAACAGG - Intronic
918006620 1:180547297-180547319 GGTCTCAGTGAGGCAGTCACTGG - Intergenic
919249111 1:195030241-195030263 GCTCTCAGTGGACCAGCAATGGG + Intergenic
919815423 1:201435118-201435140 GGTCTCAGTGTAGCAGCCCCGGG - Intergenic
920274777 1:204796016-204796038 GATCTCAGTGGAGGAGGAGCAGG - Intergenic
920338392 1:205259887-205259909 GATCTCACTGGAGCAGGAAGAGG + Intronic
920458145 1:206116659-206116681 GGGCTAAGTGCAGCACGAACAGG + Exonic
1062925263 10:1311592-1311614 GGTCTCTATGGAGCAGGCAGGGG - Intronic
1063381796 10:5590451-5590473 GGTCTCTTTGGAGCAGGTTCGGG - Intergenic
1064219168 10:13425006-13425028 GGTGTCTGTGAACCAGGAACAGG + Intergenic
1064894293 10:20216390-20216412 GGGCTCAGAGGTGCAGGAACTGG + Intronic
1066745872 10:38604018-38604040 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
1067170099 10:43899042-43899064 GGTATCAGTGCAGCAGGCAGGGG + Intergenic
1067444508 10:46332403-46332425 GGTCTCAGAGTTGCAGGGACGGG - Intergenic
1067455033 10:46413084-46413106 GGTCTAAAAGGAGCAGGCACTGG - Intergenic
1067632171 10:47971550-47971572 GGTCTAAAAGGAGCAGGCACTGG + Intergenic
1067702166 10:48581876-48581898 GCTTTCAGTGCAACAGGAACTGG - Intronic
1067776027 10:49165490-49165512 GGTCTGAGTGGGGGTGGAACAGG + Intronic
1068705510 10:60071244-60071266 GGAGTCAGAGGAGGAGGAACAGG - Exonic
1069623946 10:69855644-69855666 GGACTCCGTGAAGCAGGGACAGG - Intronic
1069779951 10:70948954-70948976 GGCCTTAGTGGAGCAGAGACAGG + Intergenic
1071521360 10:86333049-86333071 GGTCTCCCAGGAGCAGGAGCTGG - Intronic
1073024063 10:100473430-100473452 GGACTGAGGGGAGGAGGAACGGG - Intronic
1073072812 10:100805602-100805624 AGACTCAGGGGAGCAGGCACCGG + Intronic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1075443637 10:122498887-122498909 GTTCTCAGGGGACCAGGGACTGG - Intronic
1076735059 10:132455265-132455287 GGTCTCTGTGCTGCTGGAACTGG - Intergenic
1077755271 11:5021881-5021903 TGTCTCAGTGGGGCAGAAGCTGG + Intergenic
1079158700 11:17973259-17973281 GGTCCCACAGGAGCAGGATCAGG + Intronic
1079563952 11:21857947-21857969 GATTTCAGTGGAGCGGTAACTGG + Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1081673013 11:44951924-44951946 GGTCACAGTGGGCCAGGAACCGG + Intergenic
1081808081 11:45900815-45900837 GGTGAAAGTGGAGCAGGAGCAGG + Intronic
1083256203 11:61496779-61496801 GGTCTCGGATGAGCAGGAATGGG + Intergenic
1083429230 11:62605313-62605335 GGTATCACTGGAGCCTGAACAGG + Intronic
1083595275 11:63916002-63916024 GGTCTGGCTGGAGCAGGGACTGG - Intronic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1084271952 11:68033659-68033681 GGCCTCAGGGGAGCAGCCACTGG - Intronic
1086724683 11:90167469-90167491 GGTCGCCGTGGAGCAGGAAGCGG - Intronic
1090669918 11:128938852-128938874 GGTCTCAGGGCAGCAGGGAGTGG + Intronic
1091066143 11:132514989-132515011 GGGCTAAGTGGAGCAGGAGGAGG + Intronic
1091769422 12:3141460-3141482 GGCCTCAGAGGAGCAGGGCCCGG - Intronic
1099286416 12:80717945-80717967 GGCCTCATTGGAGCAGGAACTGG - Intronic
1103436872 12:120933506-120933528 GGACACAGTGGGGCAGGAATTGG - Intergenic
1103727047 12:123003201-123003223 GTTCTCAGAGGAGCAGGAGGAGG - Intronic
1103815957 12:123656651-123656673 GCTACCAGTGGAGCAGGAAGAGG - Intronic
1104691515 12:130829741-130829763 GGTCTCAGAGGCGCAGGGCCAGG + Intronic
1104875848 12:132034260-132034282 GGCCTTAGCGGTGCAGGAACAGG + Intronic
1105399277 13:20074016-20074038 GGGCTCAGTAGAGAAGGAAATGG - Intronic
1106022249 13:25926484-25926506 GGACTCTGGGGAGCAGGAACTGG + Intronic
1107851268 13:44575935-44575957 GCTCTCAATGCAGCAGGTACCGG - Exonic
1113814813 13:113162792-113162814 GGACAGAGTGGAGCAGGGACGGG - Intronic
1113968319 13:114167304-114167326 GGTGTCAGTGGAGAAGGGGCCGG + Intergenic
1114613745 14:24057760-24057782 GGTCTCAGGGGAGCTGGAAGGGG - Intronic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1118526191 14:66646718-66646740 GGGTTCAGTGGAGTAGGAAATGG + Intronic
1118671917 14:68137832-68137854 CTTCTCAGAGGAGCAGCAACAGG - Intronic
1119034037 14:71215116-71215138 GGTCTGTGTGCAGCAGGAAGTGG - Intergenic
1122339818 14:101020587-101020609 GGTCTGTGTGGGGCATGAACTGG - Intergenic
1125095166 15:35842285-35842307 GATGTGAGTAGAGCAGGAACTGG + Intergenic
1125954185 15:43777738-43777760 GGTCTCAGTGCACCAGGATCTGG - Intronic
1126798652 15:52280975-52280997 GGTAACAGGGGAGCAGGAGCTGG - Intronic
1127211169 15:56776415-56776437 GGTCTCAGTGTTACAGGAAAGGG + Intronic
1127834845 15:62782647-62782669 GGTCGCAGTGGAGCAGCACGTGG + Intronic
1128061463 15:64738362-64738384 GGTCTGAGTGGAGGAGGAGCCGG - Intergenic
1128308217 15:66613861-66613883 GGTCTGAGTGGAGGAGGAGGAGG + Intronic
1128533453 15:68471075-68471097 GACCTCAGAGGAGCAGGACCAGG + Intergenic
1129546803 15:76404242-76404264 GATCTCAGTGGAAGAGGGACTGG + Intronic
1130096618 15:80860930-80860952 GGTGGCATTGGAGCAGGCACCGG - Intronic
1131174370 15:90201068-90201090 GGTCCCAGAGGAGCCGGAAGGGG + Intronic
1132567369 16:629698-629720 GGTCACAGCTGAGCTGGAACGGG + Intronic
1133080454 16:3314950-3314972 GGTCTCAGTGTTCCAGGAGCTGG + Intronic
1133536148 16:6704263-6704285 TATCTCTGTGGAGCAGGGACTGG - Intronic
1136393797 16:29982021-29982043 GCTCTTGGTGGAGGAGGAACTGG - Intronic
1136862130 16:33710721-33710743 GGTAACAGTAGAGCAGGTACAGG - Intergenic
1137378564 16:47976411-47976433 GGACTCAGTGGAGCAGGTTGAGG - Intergenic
1139435388 16:66933919-66933941 GGTTTCTGTGCAGCAGGAGCTGG - Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1140237771 16:73174224-73174246 GGCCTCAGTGGATCAGGAATGGG + Intergenic
1141089556 16:81120989-81121011 GGTCTCAGTTCAGTAGAAACAGG + Intergenic
1141813002 16:86388745-86388767 GGTCTCAGTGGAGCACTGGCTGG - Intergenic
1142330566 16:89449930-89449952 GTGCTCAGTGAAGCAGGAGCTGG - Intronic
1143684205 17:8500834-8500856 GCTCTCAGAGCAGCTGGAACAGG - Exonic
1143726507 17:8850577-8850599 GGTCACAGTGGAGCAGACAGAGG - Intronic
1145749390 17:27344333-27344355 GGTCTCACTGGGGCAGGGAGAGG - Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1148774403 17:50087587-50087609 GCTGTCAGTGGGGCAGGCACAGG + Intronic
1151453202 17:74211855-74211877 GGCCTCTGTGCAGAAGGAACAGG - Intergenic
1151673805 17:75588111-75588133 GGCCTCAGGGGAGCAGGAGTCGG + Intergenic
1151999281 17:77635262-77635284 GGTCACAGTGGCCCAGGAGCTGG + Intergenic
1152261708 17:79270716-79270738 AGGCCCAGTGGAGGAGGAACAGG - Intronic
1156935777 18:42705180-42705202 GACCTCAGTGGAGTAGAAACTGG + Intergenic
1157761303 18:50267499-50267521 GGTCACAGTGGACCAGGGTCAGG + Intronic
1160282171 18:77501439-77501461 GAGCTCAGTGGAGCAGCCACAGG - Intergenic
1161331206 19:3688546-3688568 GCTCTCAGTGGACCAGGGAAAGG - Intronic
1161381268 19:3966340-3966362 GGACTCAGTGGCCCAGGAAAGGG + Intronic
1162292683 19:9791843-9791865 GGTCTCAGTGGGGGAGAGACAGG - Intronic
1162737221 19:12753429-12753451 GATCTCAGAGGGGCAGGAATGGG - Intronic
1162908306 19:13836288-13836310 TGGCTCAGTTCAGCAGGAACAGG - Intergenic
1163003257 19:14382019-14382041 GGTCTGCGGGGAGCAAGAACTGG - Intronic
1163680378 19:18678121-18678143 GGGGTCAGTGGAGCAAGAAGCGG + Intergenic
1164740405 19:30571647-30571669 GGTCACAGAGAAGCAGGAGCAGG - Intronic
1164801661 19:31081723-31081745 GGTGGCAGTGGAGGAGGAAATGG + Intergenic
1165550791 19:36583400-36583422 GGTTTCAGTGGAGCTGAACCTGG - Intronic
1166482788 19:43187500-43187522 GCTCTCTGTAGAGGAGGAACAGG + Intronic
1166485263 19:43206634-43206656 GCTCTCTGTAGAGGAGGAACAGG + Intronic
1167762193 19:51456986-51457008 AGTCTAAGGGGAGCAGGGACAGG + Intronic
1168055969 19:53865647-53865669 GGGTTCAGGGTAGCAGGAACAGG - Intergenic
1168144883 19:54415441-54415463 GGGCTCAGGGGAGCGGGAGCGGG - Intronic
1168502057 19:56901000-56901022 GGTTTTAGTGGAGTAGGAAATGG + Intergenic
925134023 2:1514211-1514233 GGCCCCAGTAGAGCAGGAAGTGG - Intronic
925508991 2:4603522-4603544 GTTCTCAGTGGGGAAGGAGCGGG - Intergenic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
927648753 2:24898256-24898278 GGCCTCTGTGGCGCACGAACTGG - Intronic
927773502 2:25884094-25884116 GGTGACAGTGGAGCATGAAATGG - Intergenic
928128813 2:28634403-28634425 GGTCTCAGGGGAAAAGGAACAGG - Intronic
928341576 2:30447443-30447465 GATCTCAGAGGTGCAGGAAGGGG + Intronic
930605212 2:53486359-53486381 GGGCGCTGTGGAGCAGGAAGTGG - Intergenic
933251629 2:80035736-80035758 GTTCTCAGAGAAACAGGAACTGG + Intronic
934308275 2:91843211-91843233 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
935872795 2:107469457-107469479 GGGCTCAGCGGAGCAGGAGGAGG + Intergenic
942595606 2:177589330-177589352 GGGGTCAGTGAAGCAGGTACAGG - Intergenic
944677465 2:202046207-202046229 GGTGTCAGTGGCTCAGGAACAGG - Intergenic
945668934 2:212778925-212778947 GGTCTCAGTGGAGCACGTCAAGG - Intergenic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946910334 2:224454416-224454438 GGTATCAGTGAAGCAAGAACAGG - Intergenic
947500301 2:230666604-230666626 GGTCCCAGTGGAGATGGAAAAGG - Intergenic
947724597 2:232388872-232388894 GCTCTCCCTGGATCAGGAACTGG - Intergenic
948466701 2:238155664-238155686 GGGATCACTGGAGCAGGAAGTGG - Intergenic
1169254264 20:4085305-4085327 GGGCTCAGGGGAGCAGCTACTGG + Intergenic
1172096119 20:32461285-32461307 GGACAGAGTGGAGCAGGAAGAGG - Intronic
1173825813 20:46047127-46047149 GGTCTCAGGGGAGTGGAAACGGG - Intronic
1174388361 20:50200638-50200660 GGCCTCAGTGGAGCAGGTGGTGG - Intergenic
1174849995 20:53984714-53984736 GGTCTGAGTGGTGCAAGGACAGG - Intronic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176091652 20:63321047-63321069 GGTCTCTGAGGAACAGGAACAGG - Exonic
1176103382 20:63374636-63374658 GGTCTCAGAGTAGCAGGCTCAGG + Intronic
1176196232 20:63837344-63837366 GGACATAGTGGAGCAGGCACGGG + Intergenic
1176715657 21:10347132-10347154 GGTCTCATGAGAGCAGGGACTGG - Intergenic
1179889025 21:44326566-44326588 GGTATCCGTGGAGCTGGGACAGG - Intronic
1180535359 22:16390290-16390312 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
1180602687 22:17032821-17032843 GGTCTCATGAGAGCAGGGACTGG + Intergenic
1180629588 22:17219215-17219237 ACTCTCAGTGGAGGAGTAACAGG - Intronic
1180825014 22:18855928-18855950 GGTCTCAGTGGCCCAGGACAAGG + Intronic
1181187717 22:21118620-21118642 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1181211481 22:21291873-21291895 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
1181500764 22:23314385-23314407 GGTCTCAGTGGCCCAGGACAAGG - Intronic
1181651385 22:24261046-24261068 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
1181673339 22:24436324-24436346 TTTCTGAGTGGAGCAGGAAACGG - Intronic
1181705993 22:24649693-24649715 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1181846414 22:25712887-25712909 GCTCTCACGGGAGCAGGACCTGG - Intronic
1181859180 22:25805106-25805128 GCTCTCAGTGGGGATGGAACTGG + Intronic
1183333636 22:37234563-37234585 GGTCTCAGTGGACCAGGTCAGGG - Intronic
1183676083 22:39299589-39299611 GGTCTCAGGGGAGGCTGAACAGG - Intergenic
1183796863 22:40126186-40126208 TGCCTCTGTGCAGCAGGAACAGG - Intronic
1203215467 22_KI270731v1_random:3558-3580 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1203275159 22_KI270734v1_random:81833-81855 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954239106 3:49279604-49279626 AGTCTGGGTGGAGCAGGAACTGG - Intronic
954695617 3:52423454-52423476 AGTCTCAGTGGAGCATGAGGAGG + Exonic
955123456 3:56085281-56085303 CTTCTCACTGGAGCAGAAACTGG - Intronic
955208456 3:56918508-56918530 GGTAGCAGTGGAGCAGGGAGGGG + Intronic
957465609 3:80586336-80586358 GTTCCCAGTGGAGAGGGAACAGG - Intergenic
963366173 3:144337362-144337384 GGCCTCAGTGAACCAGAAACTGG - Intergenic
966548926 3:181183063-181183085 GGGCGCAGTGGAGCAGGGAGCGG + Intergenic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
967255292 3:187585510-187585532 GGACTCAGTGGAGCTGGTAGAGG - Intergenic
967357265 3:188585989-188586011 GGTCTCTTTGGGGCAGGAAGAGG + Intronic
968454447 4:689773-689795 GCTCTCAGAGGAGTAGGCACAGG + Intergenic
968620831 4:1602820-1602842 GGTCTGAGGGCAGCAGGAGCCGG + Intergenic
969383726 4:6827669-6827691 GGTCTCAGTTGTGCAGGATAAGG + Intronic
975782544 4:77854953-77854975 GGTAGCAGTGAAGCAGGAAGAGG + Intergenic
979308373 4:119174114-119174136 GGGCGCAGTGGAGCAGGAGGTGG - Intronic
979470052 4:121084896-121084918 GGGCTCTGTGGAGCTGAAACTGG - Intergenic
979881091 4:125961451-125961473 GCTCTCAGTGGAGAGGGGACAGG - Intergenic
980866476 4:138559168-138559190 TCTCTCACTGAAGCAGGAACTGG - Intergenic
981271415 4:142850560-142850582 GGACTCATTGGAGCAGGAGCTGG - Intergenic
981731782 4:147907053-147907075 GATCTCAGTGGAGATGGAACAGG + Intronic
982284818 4:153724123-153724145 GGTCTAAGTGGAGAAGGAAAAGG + Intronic
983923567 4:173371768-173371790 GGTCGCAGAGGAGAAGGAAGAGG - Intronic
983954561 4:173682096-173682118 GATCTAAGAGGAGCAGGAAAGGG + Intergenic
985877798 5:2613385-2613407 GGTCCCTGTGGAGTAGGAAGGGG - Intergenic
986327148 5:6684873-6684895 GAACACAGTGGAGCAGGCACCGG - Intergenic
986383560 5:7209102-7209124 GTGCTCAGTGGAGCGGGGACAGG - Intergenic
986588703 5:9346292-9346314 GGTCTCAGTGGAAGGGGAGCTGG - Intronic
987040889 5:14061241-14061263 CTTCTCAGTGGAGCTGGAAAGGG - Intergenic
987524996 5:19036078-19036100 AGTCTCAATGGAGCAGCCACAGG - Intergenic
990319148 5:54612717-54612739 GGTGACAGTGGAGAAGGAAAAGG - Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
991703790 5:69338781-69338803 GGTCTCAATGTAACAGGAAAGGG - Intergenic
995417587 5:111927182-111927204 GGCCTCAGTGGCGCAGGAGAGGG - Intronic
999636607 5:153629485-153629507 GGTTTCAGGGGAGCAGGAGAAGG - Intronic
1000586995 5:163112525-163112547 GGGCTCAGTGGAAAAGGTACAGG - Intergenic
1002358219 5:178648294-178648316 GGTCACAGCAGAGCAAGAACAGG + Intergenic
1002442722 5:179272766-179272788 GGTCTCAGTGGCTCAGAAATGGG - Intronic
1002896454 6:1382930-1382952 GGAGTCAGGGGAGCAGGAAGGGG + Intergenic
1003307484 6:4942852-4942874 GCCCTCAGTGGAGCAGGATGTGG + Intronic
1005870544 6:29971675-29971697 GGTGTCAGGAGAGCAGGTACTGG - Intergenic
1005925760 6:30444226-30444248 GGGATCAGTGGAGCAGGAGGAGG - Intergenic
1006541216 6:34741406-34741428 GGTCTCACTGGATCAGGGTCAGG + Intergenic
1006618353 6:35344843-35344865 GGGGTCAGTGGAGAAGGGACTGG - Intronic
1009477680 6:64114770-64114792 GTTCTCTGTGGAACAGGCACTGG - Intronic
1009561594 6:65252157-65252179 GGTCTAAGTGGAAAGGGAACTGG + Intronic
1010769665 6:79813927-79813949 GGTTTCAGTGCAGCAGGAATTGG + Intergenic
1010769699 6:79814288-79814310 TCTATCAGTGGGGCAGGAACTGG + Intergenic
1012282905 6:97350297-97350319 GTTTTTAATGGAGCAGGAACTGG + Intergenic
1013298162 6:108778580-108778602 CCTCTCAGTGTAGCAGGAATAGG - Intergenic
1013474978 6:110498824-110498846 GGGCTCCGTGGAGCAGGGACAGG - Intergenic
1014055938 6:117015082-117015104 GGGCTCCGTGGAGCAGGGAGCGG - Intergenic
1016007955 6:139108474-139108496 GGTGTCGGTGGAGCAGGGGCGGG - Intergenic
1016516454 6:144897674-144897696 GGGCTCTATGGAGAAGGAACTGG - Intergenic
1017019782 6:150130862-150130884 GGTCTGGGAGGAGCAGGAAGAGG + Intergenic
1017505607 6:155066110-155066132 CGTCTCAGTGGAGAAGGCCCAGG - Intronic
1017946294 6:159099006-159099028 GGTCTCCATGGAGCAGGGCCCGG - Intergenic
1019413225 7:915674-915696 GATTCCAGTGGGGCAGGAACAGG + Intronic
1019455853 7:1127148-1127170 GGTCTCTGTGGAGCAGAGCCTGG - Intronic
1019515547 7:1438347-1438369 GGTCTCCCTGGAGAAGGAGCAGG + Exonic
1019537606 7:1537404-1537426 GCTCGCAGTGGAGCTGGAAGCGG + Intronic
1019574782 7:1732128-1732150 GGTCACAGCGGAGCAAGCACAGG + Intronic
1019607011 7:1915031-1915053 GGCCACAGAGCAGCAGGAACTGG + Intronic
1019664799 7:2246483-2246505 GGTGTGAGTGGAGCAGGCAGCGG + Intronic
1021959072 7:25854308-25854330 GGTCTCACTGGAGCAGAGCCTGG - Intergenic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1023608361 7:41950050-41950072 GGTAGCAGTGGAGCAGCAGCAGG + Intergenic
1023821219 7:43981655-43981677 GGTCTCAGTGGTGCAGTCCCTGG - Intergenic
1024366691 7:48528641-48528663 GAACTCAGGGGAGCAGGAAATGG + Intronic
1024628735 7:51230449-51230471 AGCAACAGTGGAGCAGGAACGGG - Intronic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1028872724 7:95786804-95786826 TGTCACAGTGTAGCAGGGACTGG + Intronic
1029749488 7:102535079-102535101 GGTCTCAGTGGTGCAGTCCCTGG - Intergenic
1029767435 7:102634182-102634204 GGTCTCAGTGGTGCAGTCCCTGG - Intronic
1030008547 7:105142323-105142345 ATTCTCACTGGAGCAGCAACTGG - Exonic
1030819264 7:114076882-114076904 GGGCGCCGTGGAGCAGGAAGCGG + Intergenic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1033670510 7:143488587-143488609 GGCCTCAGCTGAGCAGGAAAAGG - Intergenic
1034294920 7:149963664-149963686 GGTAACAGTGGAGAAGTAACAGG + Intergenic
1035272719 7:157729932-157729954 GGATTCAGTGGGCCAGGAACAGG + Intronic
1035685003 8:1517450-1517472 GCTCTCAGTGGAGCAGGGGGTGG - Intronic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1037665282 8:20963742-20963764 GGTCTCATTGGAGCAGGGCTAGG + Intergenic
1038564213 8:28606358-28606380 GGACTGAGGGCAGCAGGAACGGG - Intronic
1039895308 8:41712955-41712977 GGACTCACTGCAGCAGGGACAGG + Intronic
1039926925 8:41942852-41942874 GGTCTCAGAGGAGGAAGAAGAGG - Exonic
1045233266 8:100326558-100326580 GGTATCAGTAAAGCAGGAAAGGG - Intronic
1046219272 8:111192480-111192502 GGCATCAGTGGAGCAGGAGAGGG + Intergenic
1047826447 8:128581620-128581642 GCTCTAAGTAGAGCAGGGACTGG + Intergenic
1049772318 8:144389193-144389215 GGTATCTGTTGAGCAGGTACTGG - Intronic
1052916359 9:33926843-33926865 GGGCTCAGTGGGGCAGAGACGGG + Intronic
1056816970 9:89808917-89808939 CGTCTCAGTGGGGCATGTACTGG - Intergenic
1057441356 9:95086064-95086086 TGGCTCAGTTCAGCAGGAACAGG + Intronic
1058469604 9:105263905-105263927 GGTCTCAGGGCAGCAGAAAATGG - Intronic
1058499402 9:105595162-105595184 GGGCTGAGTGGAGGAGGAAAGGG + Intronic
1059651219 9:116318121-116318143 GGGCTCTGGAGAGCAGGAACTGG - Intronic
1060483835 9:124034485-124034507 GGAGTGAGTGGGGCAGGAACGGG + Intergenic
1060503453 9:124180621-124180643 GGACTCAGAGGACCAGGAAGAGG - Intergenic
1062547625 9:137070742-137070764 GGCCAGAGTGGAGCAGGAGCTGG - Intergenic
1185432067 X:17276-17298 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185441383 X:229990-230012 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1189488013 X:41447479-41447501 GACCTCAGAGGAGCAGGACCAGG + Exonic
1190925303 X:54898299-54898321 GGTGTCAGTGAAGCAGGGAAGGG + Intergenic
1191090604 X:56616623-56616645 GCTCTCAGTGGAGAAGGGATGGG + Intergenic
1196319486 X:114270593-114270615 GGGCACCGTGGAGCAGGAAGCGG + Intergenic
1199977278 X:152901808-152901830 GGTCTGAGTGGAGAAGAGACTGG + Intergenic
1200111486 X:153743141-153743163 GGGCTCAGTGGAGCCTGAGCCGG + Intronic