ID: 1081657805

View in Genome Browser
Species Human (GRCh38)
Location 11:44868773-44868795
Sequence CTCACTTTCTGCCCTGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 219}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081657805_1081657816 16 Left 1081657805 11:44868773-44868795 CCCACACCAGGGCAGAAAGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1081657816 11:44868812-44868834 CCGCTGGCTGGAGGGCCAGATGG 0: 1
1: 0
2: 1
3: 24
4: 219
1081657805_1081657817 17 Left 1081657805 11:44868773-44868795 CCCACACCAGGGCAGAAAGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1081657817 11:44868813-44868835 CGCTGGCTGGAGGGCCAGATGGG 0: 1
1: 0
2: 0
3: 15
4: 195
1081657805_1081657812 4 Left 1081657805 11:44868773-44868795 CCCACACCAGGGCAGAAAGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1081657812 11:44868800-44868822 GTCTGAAATAGGCCGCTGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 78
1081657805_1081657814 8 Left 1081657805 11:44868773-44868795 CCCACACCAGGGCAGAAAGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1081657814 11:44868804-44868826 GAAATAGGCCGCTGGCTGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
1081657805_1081657810 -7 Left 1081657805 11:44868773-44868795 CCCACACCAGGGCAGAAAGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1081657810 11:44868789-44868811 AAGTGAGGCAGGTCTGAAATAGG 0: 1
1: 0
2: 2
3: 15
4: 192
1081657805_1081657818 18 Left 1081657805 11:44868773-44868795 CCCACACCAGGGCAGAAAGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1081657818 11:44868814-44868836 GCTGGCTGGAGGGCCAGATGGGG 0: 1
1: 0
2: 0
3: 41
4: 399
1081657805_1081657813 7 Left 1081657805 11:44868773-44868795 CCCACACCAGGGCAGAAAGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1081657813 11:44868803-44868825 TGAAATAGGCCGCTGGCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1081657805_1081657811 0 Left 1081657805 11:44868773-44868795 CCCACACCAGGGCAGAAAGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1081657811 11:44868796-44868818 GCAGGTCTGAAATAGGCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081657805 Original CRISPR CTCACTTTCTGCCCTGGTGT GGG (reversed) Intronic
900412074 1:2517132-2517154 CTCAGCTTTTGCCCTGCTGTTGG - Intronic
900656852 1:3762832-3762854 CTCACCTGCTCCCCTGGAGTGGG - Intronic
900947062 1:5837009-5837031 CTGGCTTTCTGCCCTGGAGCTGG - Intergenic
902744128 1:18461830-18461852 CTCACGTTCTGTCCTCGTGGAGG + Intergenic
904698375 1:32343468-32343490 CTCTCTTTCTGCCCTGGGGAGGG + Intergenic
905010212 1:34742110-34742132 CTCACTTTGTGCTCAGTTGTGGG + Intronic
905462419 1:38130322-38130344 TTCACTTTCTGCCCTGTTCTGGG - Intergenic
906072311 1:43026010-43026032 CGCCCTTTCTGCTCTGGGGTTGG - Intergenic
906975997 1:50573711-50573733 CTCACTTTCTGAGCAGATGTTGG + Intronic
908578389 1:65486694-65486716 CTCACTTTCAGCCTTAGTGTTGG - Intronic
909922558 1:81400486-81400508 CACACTTTCTTCCCTAGAGTTGG - Intronic
910339890 1:86173992-86174014 CTCACTTTCTACCCTCAGGTAGG + Intergenic
911088699 1:94000913-94000935 CTCACATTCTTCCATGCTGTGGG + Exonic
911228859 1:95338188-95338210 TTCACTTTCTGCCATGATGGAGG + Intergenic
911347520 1:96714971-96714993 CTCATTTTCTCCCCTAGTTTAGG + Intergenic
911476758 1:98382596-98382618 CTCCCTCTCTGCCCTGGCCTTGG - Intergenic
912588462 1:110788509-110788531 CTCCTTTTCTTCCCTGGAGTTGG + Intergenic
912872767 1:113324984-113325006 CTCACTTTTTGCCCTGTTTAAGG + Intergenic
912872849 1:113326089-113326111 CTCACTTTTTGCACTGGTTAAGG + Intergenic
913013900 1:114713382-114713404 ATCACTTTCAGCCCAGGAGTTGG - Intronic
915517598 1:156422117-156422139 CCATCTTTGTGCCCTGGTGTTGG - Intronic
915565907 1:156712581-156712603 CTCCCTATCGGCCCTGGTGTGGG + Intergenic
919798620 1:201337126-201337148 CTCCCTTTCTGCCCAGGAGTGGG + Intergenic
920070954 1:203302815-203302837 TTCACTATGTGGCCTGGTGTGGG + Intergenic
920254344 1:204644331-204644353 CTCCCTTTCTGTCCTGGTGATGG + Intronic
923804023 1:237238594-237238616 CTCACTTTGTCCTCTGGTCTTGG + Intronic
924555587 1:245115731-245115753 CCATCATTCTGCCCTGGTGTTGG - Intronic
1063139064 10:3240588-3240610 CTCACTTTCTGTCATGGTCGTGG - Intergenic
1063168879 10:3487974-3487996 CTTGCTCTCTGCCCTGGTGGAGG + Intergenic
1064086721 10:12350686-12350708 TTCCCTTTCTGCCCAGGAGTTGG + Intronic
1064191454 10:13209450-13209472 CTTACTTTCTGCCATTGGGTTGG + Exonic
1065115504 10:22479060-22479082 TTTTCTTTCTGCTCTGGTGTGGG + Intergenic
1066575547 10:36820348-36820370 TTCACCTGCTGCCCTGGTGCAGG + Intergenic
1068106280 10:52620774-52620796 CACTGTTTTTGCCCTGGTGTAGG - Intergenic
1069826555 10:71258357-71258379 CTCTCTTTCTGTCCTGGACTTGG - Intronic
1070051751 10:72896103-72896125 TTCACTTCCTCCCCTGCTGTAGG - Intronic
1070609012 10:77920724-77920746 CTCCCTTTCTTCCCTGGTCAGGG + Intronic
1071293817 10:84205133-84205155 CTCAGTTGCTGCCCAGCTGTGGG - Intronic
1073531926 10:104240111-104240133 CTCACATTCTGCTCTAGGGTTGG - Intronic
1074117094 10:110464523-110464545 CTGGCTTTGTGCCCTGGGGTGGG - Intergenic
1074586682 10:114774682-114774704 TTCACATTCTGCCCTGGCTTTGG - Intergenic
1075795897 10:125119146-125119168 CTCACCTTCTGGCCCTGTGTAGG - Intronic
1076741191 10:132486531-132486553 CTCACTTTTTGCCCATCTGTTGG - Intergenic
1077583726 11:3434933-3434955 TCCACTTGCGGCCCTGGTGTGGG - Intergenic
1079042006 11:17067739-17067761 GGCATTTTCTGCCCTGGTCTCGG + Intergenic
1081657805 11:44868773-44868795 CTCACTTTCTGCCCTGGTGTGGG - Intronic
1082012712 11:47461186-47461208 CTCACTTTGTTCCCTGGGCTGGG + Intergenic
1082790132 11:57341500-57341522 CTCTCTGTGTGCCCTGGAGTGGG - Intronic
1085151842 11:74258644-74258666 CTCTCCTTCTGCTATGGTGTGGG - Intronic
1085454544 11:76658352-76658374 CTTCCTTTCCACCCTGGTGTGGG - Exonic
1086482556 11:87258536-87258558 CTCACTTTCTCCTGTGGGGTAGG - Intronic
1089075878 11:115738008-115738030 CTTACATTCTCCCCTGGTGCTGG - Intergenic
1090413799 11:126527040-126527062 TCCTGTTTCTGCCCTGGTGTGGG - Intronic
1090795317 11:130130828-130130850 CTCACTTACTGCACGGGTGCTGG + Intronic
1092236161 12:6811094-6811116 CCCTCTTTCTGCCTTGGTGTGGG - Intronic
1094048264 12:26191446-26191468 CTCTCTTTCTTCCCTGGAGATGG - Intronic
1095354527 12:41255891-41255913 CTCACTTATTGCCATGGGGTGGG + Intronic
1098013353 12:66078125-66078147 CCCAATTTCTGCCCTCATGTTGG + Intergenic
1103359978 12:120347747-120347769 CTCAATTTCTCCCCTGGTCTGGG + Intronic
1105029992 12:132875350-132875372 CGCACATTCTGGCCGGGTGTGGG + Intronic
1106489033 13:30200243-30200265 ATCCCTTTCTGCCCTGTTCTGGG + Intergenic
1106637553 13:31545084-31545106 ATAACTTTCTGCCCTCTTGTGGG + Intergenic
1112130599 13:96519520-96519542 CTCACTTCCAGCCCTATTGTTGG - Intronic
1115564358 14:34612461-34612483 CTCACTTTGTCCCCTGAGGTTGG + Intronic
1117006384 14:51425208-51425230 CTCATTCCCTGCCCTGGTCTTGG + Intergenic
1117449884 14:55839879-55839901 TCCACTTGCAGCCCTGGTGTGGG + Intergenic
1118892204 14:69919918-69919940 CCCCCTTTCTCCCCTGGAGTAGG + Intronic
1118910539 14:70058679-70058701 GTCACTCTCTGTCCTGCTGTTGG + Intronic
1119330818 14:73792280-73792302 CTCCCTTTCTGGCCTGCTGGGGG + Intergenic
1120441476 14:84546359-84546381 CTCACTTTCTTCCTCGGTGGGGG + Intergenic
1122267456 14:100553362-100553384 CCCTCTTTCTGCCCTGGAATGGG - Intronic
1122356534 14:101126173-101126195 CTCCATCTCTGCCCTGGGGTTGG - Intergenic
1124939407 15:34204096-34204118 TTAACTTTCTGGCCTGTTGTTGG - Intronic
1125073316 15:35582477-35582499 CAGACTTTCTGCCCTGGGATGGG + Intergenic
1125477323 15:40055891-40055913 CTCTCTTCCTGCTCTGGTATGGG - Intergenic
1130425035 15:83788663-83788685 CTAACGTTATGCCTTGGTGTGGG + Intronic
1130531827 15:84752954-84752976 CTCACTTTCTGGCCAGGGCTGGG + Intronic
1134744451 16:16576937-16576959 CTTTCTTTCTGCCATGGTGATGG + Intergenic
1135175046 16:20220697-20220719 TTCACTTTCTACTCTGTTGTAGG + Intergenic
1135286482 16:21197843-21197865 CTCAGGTTCTTCCCAGGTGTCGG - Exonic
1137447824 16:48542909-48542931 TGCGCTTTCTGCCATGGTGTTGG - Exonic
1137821074 16:51446519-51446541 CTCACTTTCTGCCCAGGCCTTGG + Intergenic
1138120531 16:54397583-54397605 CTCACTTCCTGCCCTGGACTTGG - Intergenic
1138483363 16:57318731-57318753 CTCACGTCCTTCCCTGGGGTGGG + Intergenic
1139898612 16:70309153-70309175 GTCCCTTTCTGCTTTGGTGTTGG - Intronic
1141153164 16:81578774-81578796 CTCCCTTCCTGCACTGGCGTCGG + Intronic
1141942824 16:87289740-87289762 CTCTCTCCCTGCGCTGGTGTGGG - Intronic
1143165443 17:4895156-4895178 CTCACTGTGGGCCCGGGTGTTGG - Exonic
1143627459 17:8118696-8118718 CTCATTCTCTGCTCTGGAGTAGG + Exonic
1144763042 17:17718091-17718113 CTCAGTCTCTGCCCTGGGCTGGG - Intronic
1145282650 17:21478839-21478861 CTCTCTTCTTGCCCTTGTGTGGG - Intergenic
1145394828 17:22486916-22486938 CTCTCTTCTTGCCCTTGTGTGGG + Intergenic
1146318844 17:31830781-31830803 CTCAGTTTCTTACCTGGTGAAGG - Intergenic
1147561595 17:41512745-41512767 CTCATTTTCTGCCCTCGGTTTGG + Intergenic
1147968552 17:44207211-44207233 CTCCCTGGCTGCCCTGGGGTGGG + Exonic
1148294069 17:46484633-46484655 CTCACTTTCTGTCATTTTGTGGG + Intergenic
1148316252 17:46702336-46702358 CTCACTTTCTGTCATTTTGTGGG + Intronic
1149639192 17:58192280-58192302 TTCAGTTTCTGCCCTGTTGCAGG + Intergenic
1151088211 17:71405577-71405599 CTCCTTTTCTGCCATTGTGTGGG + Intergenic
1152387928 17:79986259-79986281 CTCACTTTATTCACTGGTCTTGG + Intronic
1152766790 17:82145769-82145791 CTCACTCCCCGCCCTGGTCTCGG + Intronic
1153003412 18:476586-476608 CTCCCTTTCTGCACTGGGGCGGG - Intronic
1153983134 18:10329575-10329597 CTCGCTTCCTGCCCTGGCCTTGG + Intergenic
1154122736 18:11664731-11664753 CTCGCTTTCTGCCAGGCTGTGGG + Intergenic
1154985412 18:21546186-21546208 CTCACTAGCTGCCCTGCTTTGGG + Intronic
1157971413 18:52273916-52273938 CGGACTTTCTTCCCTGGGGTGGG + Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1162478567 19:10915250-10915272 CTCCCCTTCTGCCCTGATGGTGG + Intronic
1162585171 19:11553918-11553940 CCCACTGTGTGCCCTGGTGCAGG - Intronic
1163371011 19:16901301-16901323 CTCTCTCTCTCCCCTGTTGTTGG - Intronic
1164467167 19:28497180-28497202 CACACTTTCAGCCCTGGGTTTGG - Intergenic
1165466681 19:35978860-35978882 CTGACTTCCTGCCGTGGTGCTGG + Intergenic
1165476676 19:36034683-36034705 CTCCCTCTCTGCCCTGTTTTAGG + Intergenic
1166029405 19:40115562-40115584 CACCTTTTCTGCCCTGGTGATGG - Intergenic
1166323023 19:42030952-42030974 CCCACTTTCTGTCCTGATTTAGG - Intronic
1166782541 19:45350035-45350057 CTTACTTCCTGCCCTGGGGATGG - Exonic
927333465 2:21892897-21892919 CTCACTTTCTACCCTGAGGCAGG + Intergenic
928755891 2:34525323-34525345 CTAACTTTCTGCCCTCAAGTTGG - Intergenic
929002598 2:37362884-37362906 CTCACTTACCTGCCTGGTGTGGG - Intronic
929920515 2:46168130-46168152 CTCACACTCTTCCCTGGAGTGGG - Intronic
930755432 2:54967944-54967966 CTCACCTCCTGCCCTGCGGTCGG + Intronic
933919508 2:87030502-87030524 ATCTCTTTCTGCCCTCATGTTGG - Intergenic
934003486 2:87739400-87739422 ATCTCTTTCTGCCCTCATGTTGG + Intergenic
936379578 2:111972508-111972530 CTCTCTTTCTGCCATGGTTTTGG + Intronic
938742872 2:134249107-134249129 CTTAGTTCCTGCCCTGGTCTTGG + Intronic
939290290 2:140185298-140185320 CTTACTTCATACCCTGGTGTTGG - Intergenic
942589641 2:177528544-177528566 CTCACTTTCTACCATTGTTTAGG + Intronic
945030819 2:205662231-205662253 CTCTCTTTATGCCCTGGTAGTGG - Intergenic
945098398 2:206240730-206240752 CTCTCTTTGTGACCTGGAGTTGG + Intergenic
947804767 2:232958438-232958460 CTCAGCTTCTGCCCGGGAGTCGG + Intronic
1168889764 20:1287412-1287434 CTTAATTTTTGCCCTGGTGAGGG + Intronic
1168954450 20:1825090-1825112 TTCACTTCCTGCCCGGGAGTTGG + Intergenic
1169568450 20:6881210-6881232 CTGACTTTCTGCCCTTATGTAGG - Intergenic
1169806713 20:9567170-9567192 AGCACTTTCTGCCCTGGGCTAGG - Intronic
1169944695 20:10976199-10976221 CTCATTTTCAGTCCTGCTGTTGG + Intergenic
1169985725 20:11441739-11441761 CTTACTTTCTGCTCTGAGGTTGG - Intergenic
1170575680 20:17659811-17659833 CTGTCTTTTTGCCCTGGTTTGGG + Intronic
1170575688 20:17659841-17659863 CTGCCTTTCTGCCCTGGTTTGGG + Intronic
1170957119 20:20991560-20991582 CTGACCCTCAGCCCTGGTGTGGG - Intergenic
1171085545 20:22235279-22235301 CTCACTTTGTGCCCTTGTCCTGG - Intergenic
1171204445 20:23267934-23267956 CTCACTTGCTGCCTGGGAGTTGG - Intergenic
1171763834 20:29238310-29238332 CTCACTCTGGGCCCTGTTGTGGG + Intergenic
1172206115 20:33164052-33164074 CTCACCTACTGCCCTGGAGTTGG + Intronic
1172837739 20:37883741-37883763 CTTCCTGTCTGCCCTGGTGCCGG - Intergenic
1176008761 20:62880725-62880747 CCCACTTTCTGTCCTGGTGGGGG + Exonic
1176064484 20:63187577-63187599 CTCACCTCCTGCCCTGATGTAGG + Intergenic
1179557834 21:42191892-42191914 TTCACTTTCTGCACTGCCGTTGG - Intergenic
1180070163 21:45431917-45431939 TGCACTTGCTGCCCTGGTGACGG + Intronic
1183545324 22:38452362-38452384 CTGACTTTCTGCCCTGGTCCTGG + Intronic
1184324148 22:43769830-43769852 CTCACCTTGAGCCCAGGTGTTGG - Intronic
1184685616 22:46095382-46095404 CTCACCTGCTGCCCTGGGCTTGG - Intronic
949845966 3:8371340-8371362 CTCACTGTATGTCATGGTGTTGG + Intergenic
950725839 3:14916393-14916415 CTTTCTGTCTGCCCTGCTGTGGG + Intronic
950854389 3:16091681-16091703 CACACTCCCTGGCCTGGTGTTGG - Intergenic
952213335 3:31251425-31251447 CTCAGTCTCTTCTCTGGTGTTGG - Intergenic
954144540 3:48628038-48628060 TTCCCTGTCTTCCCTGGTGTAGG - Exonic
954807098 3:53226922-53226944 ACCACTATCTGCCCTGGTGGGGG + Intronic
955759134 3:62259273-62259295 CTCATTTTCTGCCCTCTTGCAGG - Intronic
955977094 3:64489701-64489723 CTCTCTTGCTTCCCTGGTGGAGG + Intergenic
959632885 3:108528806-108528828 CTGACTTTTTGCCTTGGGGTTGG + Intronic
959810988 3:110619039-110619061 CACAGTCTCTGCCGTGGTGTTGG + Intergenic
962889142 3:139656104-139656126 CTGCCTTTCTGCCCTGGTTAGGG + Intronic
964537523 3:157739753-157739775 CTCACTTGTTTCCCTGGAGTTGG - Intergenic
964545621 3:157830371-157830393 TTCACTTTCCACCCTGCTGTTGG - Intergenic
967334015 3:188322345-188322367 TTCACTGCATGCCCTGGTGTTGG + Intronic
968193848 3:196690791-196690813 CTCTCTCTCTTCCCTGGGGTGGG - Intronic
969310813 4:6352175-6352197 CTCAGCTTCTGACCTGGTGCTGG - Intronic
975475714 4:74821171-74821193 CTCACCTTCTTCCCAGGTGTGGG + Intergenic
977665522 4:99643097-99643119 CTGATTTTCTGCTCTGGTGAGGG + Intronic
977936322 4:102809855-102809877 CCCATTTTCTGTCTTGGTGTAGG - Exonic
978161842 4:105557923-105557945 CTCACCTTTTCACCTGGTGTTGG - Intronic
983365198 4:166777704-166777726 CTCACTTTGTGACCTGGGCTAGG - Intronic
984552528 4:181177853-181177875 CTCATTTTATGGCCTGTTGTAGG + Intergenic
984869024 4:184310702-184310724 ATAACTTTCTAACCTGGTGTTGG + Intergenic
987384963 5:17320341-17320363 CCCCCTGTCTGGCCTGGTGTTGG + Intergenic
988005083 5:25400267-25400289 CTCACTTCCTGCCTTGCTGATGG + Intergenic
988712155 5:33789345-33789367 CTCACTCTCAGCCCTGGGGGAGG - Intronic
988879402 5:35484732-35484754 CTCACTTCCTTGCCTGCTGTTGG + Intergenic
989395109 5:40947042-40947064 CTCACTATCTGTCCAGATGTGGG + Intronic
989488112 5:42015654-42015676 CTTTCTTTCTGCTCTGGTGGGGG + Intergenic
989694886 5:44189114-44189136 CTGACTTTATGACTTGGTGTAGG + Intergenic
989776968 5:45220681-45220703 CTCCCTTCCTGTCCTGGTATAGG + Intergenic
990879381 5:60522288-60522310 CTTTCTTTCTTCCCTGGAGTAGG - Intergenic
992191813 5:74299792-74299814 CTGTCCTTCTGCCCTGGAGTAGG + Intergenic
995037101 5:107546683-107546705 CACACTCTCACCCCTGGTGTAGG + Intronic
997361946 5:133300741-133300763 GCCACTTCCAGCCCTGGTGTTGG - Intronic
997458874 5:134038793-134038815 CTGACTTTCTCTCCTGGTTTTGG - Intergenic
998811061 5:145966339-145966361 CTCAATTTCTTCACTGATGTAGG + Intronic
1001524017 5:172415784-172415806 CTCCCTTTCTGCCCTGGCTTGGG - Intronic
1001782574 5:174382778-174382800 CTCACTTCCTGGTCTGGTGGTGG - Intergenic
1002768871 6:270575-270597 GTCACATTCTTCCCTGGTTTTGG + Intergenic
1003031097 6:2601334-2601356 CTCAATTTCTTCCATGGTATTGG - Intergenic
1005203444 6:23373430-23373452 CTCTCTTTCTTTCTTGGTGTGGG - Intergenic
1006806250 6:36791612-36791634 TTCACTTTCAGCTCTGGAGTAGG - Intronic
1007228567 6:40331886-40331908 CTCACTCTCAGCCCGGGGGTGGG - Intergenic
1014109004 6:117599717-117599739 CTGACTTTATGTCCTGGTTTAGG - Intronic
1014322089 6:119942677-119942699 CTCAGTTACAGGCCTGGTGTGGG - Intergenic
1014703974 6:124724101-124724123 CTTCCTTGCTGCCTTGGTGTTGG - Intronic
1014986987 6:128023434-128023456 CTCTCCTTCTGCCCTGGAGCTGG + Intronic
1015656438 6:135524504-135524526 CACAATTTCTGCCCTGGAGAAGG + Intergenic
1017456647 6:154606853-154606875 TCCAGTTTCTACCCTGGTGTAGG + Intergenic
1018127274 6:160693559-160693581 ATCTCTTTCTGCCCTCATGTTGG + Intergenic
1020819295 7:12945654-12945676 TTCACTTTCTTCACTGATGTAGG - Intergenic
1021297327 7:18924086-18924108 CGGATTTTCTGCCCTGATGTTGG + Intronic
1022523182 7:31020830-31020852 CTCACACTCTGCCCTTGTCTGGG + Intergenic
1024252578 7:47517623-47517645 ATCAGTTTCTGCCCTGTTGTAGG - Intronic
1025952130 7:66153574-66153596 TTCACTTTCTTCCCTGTTTTAGG + Exonic
1026050577 7:66943195-66943217 TTCATTTTCAGCCCTGATGTGGG - Intronic
1028506136 7:91572102-91572124 CCACCTTTCTGCCCTGCTGTAGG - Intergenic
1033782668 7:144691458-144691480 CTCACCTTCTGCCCTCAAGTAGG - Intronic
1035473034 7:159122529-159122551 CTCACTTTCTGCCACTGGGTGGG + Intronic
1036088721 8:5641225-5641247 CTCAGATTCTGCCTTGATGTAGG - Intergenic
1037319403 8:17629522-17629544 CTCATTCTCTGCCCTTCTGTTGG + Intronic
1037752637 8:21692732-21692754 CTCCCTCTCTGCCCTCGGGTGGG - Exonic
1037959917 8:23089204-23089226 CCCACTTTCTACCCTGAAGTAGG - Intronic
1038674862 8:29614672-29614694 TTCAGTTTCTTCCCTGGTATAGG - Intergenic
1039430274 8:37520208-37520230 CTGAATTTCTCCCCTGGAGTGGG - Intergenic
1041784224 8:61613605-61613627 CACACTTTCTGGTCTGGGGTAGG + Intronic
1041887076 8:62822594-62822616 CTCATTTTCTGCACTGATGTGGG + Intronic
1043272068 8:78347128-78347150 TTCACTTTCATTCCTGGTGTTGG - Intergenic
1048508959 8:135045070-135045092 CTCAGTGTCTGCCTTGGAGTGGG + Intergenic
1049600657 8:143505892-143505914 CTCTCTGAGTGCCCTGGTGTAGG - Intronic
1049666926 8:143849097-143849119 CTAAGTTGTTGCCCTGGTGTGGG + Intergenic
1049697122 8:143989904-143989926 CTCACTGTCTGCCGAGGGGTGGG - Intronic
1050001115 9:1077739-1077761 CTCTCCTTCTGCCCTGGGCTGGG - Intergenic
1050016977 9:1244213-1244235 CTCAGTTTCTGCTGTTGTGTTGG - Intergenic
1051331849 9:16031903-16031925 CTCAGTCTCTGCCCTGCTCTGGG - Intronic
1052518736 9:29515098-29515120 CTCACTTTGGGCCGTGGTCTCGG + Intergenic
1059253749 9:112910164-112910186 CTTACTGTCTCCCCTGGTGGAGG - Intergenic
1061779294 9:132986331-132986353 GTCACTCTCTGCTCTGTTGTCGG + Intronic
1062002738 9:134225015-134225037 CTCACTCACTGCCCTGGTGAGGG - Intergenic
1062702375 9:137914067-137914089 CTCACTTTCTCCCAAGGAGTTGG + Intronic
1185593837 X:1295337-1295359 CACAGTGTCTCCCCTGGTGTGGG - Intronic
1186398211 X:9231938-9231960 CCCCCTTTCTGCCCTGGTCCTGG - Intergenic
1187252300 X:17609548-17609570 GTCAATTTCTGCCATGGTATTGG - Intronic
1187386801 X:18856546-18856568 CTCATTTCCTGCCCCTGTGTGGG + Intergenic
1187845943 X:23537651-23537673 CTCACTTTCATTCCTGATGTTGG - Intergenic
1188273939 X:28177879-28177901 CTCAGTTTCTGCCCTGGGAAGGG - Intergenic
1194022358 X:88707679-88707701 CTCACTTTCTACCCTCTTATAGG + Intergenic
1196103168 X:111868713-111868735 CTCACCTTCTCCTCTGGTATAGG - Intronic
1197886764 X:131226311-131226333 TTCACTCTTTGTCCTGGTGTTGG + Intergenic
1199982639 X:152929264-152929286 CTCAGCCTCTGCCCTGGGGTGGG + Intronic