ID: 1081658426

View in Genome Browser
Species Human (GRCh38)
Location 11:44873249-44873271
Sequence TGAAATTCCCTGAACTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081658426_1081658434 20 Left 1081658426 11:44873249-44873271 CCATGTTAGTTCAGGGAATTTCA 0: 1
1: 0
2: 0
3: 13
4: 201
Right 1081658434 11:44873292-44873314 CAGCACTCAAGGGACCTATGTGG 0: 1
1: 0
2: 0
3: 6
4: 108
1081658426_1081658432 10 Left 1081658426 11:44873249-44873271 CCATGTTAGTTCAGGGAATTTCA 0: 1
1: 0
2: 0
3: 13
4: 201
Right 1081658432 11:44873282-44873304 GATTTTTTTCCAGCACTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 246
1081658426_1081658431 9 Left 1081658426 11:44873249-44873271 CCATGTTAGTTCAGGGAATTTCA 0: 1
1: 0
2: 0
3: 13
4: 201
Right 1081658431 11:44873281-44873303 AGATTTTTTTCCAGCACTCAAGG 0: 1
1: 0
2: 3
3: 38
4: 332
1081658426_1081658436 26 Left 1081658426 11:44873249-44873271 CCATGTTAGTTCAGGGAATTTCA 0: 1
1: 0
2: 0
3: 13
4: 201
Right 1081658436 11:44873298-44873320 TCAAGGGACCTATGTGGTCTGGG 0: 1
1: 0
2: 2
3: 10
4: 105
1081658426_1081658435 25 Left 1081658426 11:44873249-44873271 CCATGTTAGTTCAGGGAATTTCA 0: 1
1: 0
2: 0
3: 13
4: 201
Right 1081658435 11:44873297-44873319 CTCAAGGGACCTATGTGGTCTGG 0: 1
1: 0
2: 0
3: 32
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081658426 Original CRISPR TGAAATTCCCTGAACTAACA TGG (reversed) Intronic
900079511 1:845139-845161 TGGAAATCCCTGAAAAAACATGG - Intergenic
901883642 1:12208216-12208238 TGAAATTCCCTGAAAGGAGATGG - Exonic
903197704 1:21704590-21704612 TGAAATTACATGAATCAACATGG + Intronic
903624057 1:24718659-24718681 AAAAATTCCCTGAACAAATAGGG - Intergenic
904648338 1:31985539-31985561 TGAAGCTCTCTGTACTAACATGG + Intergenic
908690892 1:66779425-66779447 TGAAATGCCCTGAACTTCCCTGG + Intergenic
909834181 1:80232620-80232642 TGTAATTCTCAGAACTAACTAGG + Intergenic
915027030 1:152840889-152840911 TGAAATTCACTGTACTGAAAAGG + Intergenic
917295531 1:173515200-173515222 AGAACTTCCCTGACCTAGCAAGG - Intronic
918551639 1:185749161-185749183 TAAAATTCCCTCAACAAAGAAGG + Intronic
918614672 1:186531109-186531131 TGAAATTCACTGAGCTAAAGGGG - Intergenic
919373642 1:196763715-196763737 TGACATACCCTGAACCAAAAGGG - Intergenic
919380081 1:196848392-196848414 TGACATACCCTGAACCAAAAGGG - Intronic
920761627 1:208788662-208788684 TTAAATTCCATGCACTGACAGGG - Intergenic
923740926 1:236654481-236654503 TGAAAATCCCTGAACTATGGGGG - Intergenic
923889017 1:238190477-238190499 TGAAAATCTGTGAAGTAACATGG + Intergenic
1064782139 10:18853809-18853831 CTAAATTCCCTAAAATAACATGG - Intergenic
1065098029 10:22301706-22301728 TGGAATTCCCTGAACTTGTATGG - Intergenic
1065875457 10:29993782-29993804 TGAAACTCCCTGAACCAGCCTGG + Intergenic
1066614043 10:37278589-37278611 GGAAATTCCCTGATTTATCATGG + Intronic
1068036315 10:51764445-51764467 TGAATTTCCATGAAGTATCAAGG + Intronic
1068298684 10:55110216-55110238 TGAACTTACCTGATATAACATGG - Intronic
1073669059 10:105567011-105567033 TGCAATTCCTTGCTCTAACAAGG - Intergenic
1074749801 10:116573780-116573802 TGAAATTGCATTAACTAAGATGG - Intergenic
1074794272 10:116925296-116925318 TGATCCTCCCTCAACTAACAGGG + Intronic
1074928384 10:118097496-118097518 GGATATTCCCTGAATTAAAATGG - Intergenic
1074943015 10:118253448-118253470 TGATATTCCCTGAAGTTACTTGG + Intergenic
1075526722 10:123193358-123193380 TGAAACTCCCTGAAATTAAATGG + Intergenic
1076595179 10:131620651-131620673 GGATATTGCCTGAGCTAACAGGG - Intergenic
1077957455 11:7036205-7036227 AAAAATGCCCTGAACTAAAATGG - Intronic
1079230562 11:18645525-18645547 GGAAACTTCCTGAACTATCACGG + Intergenic
1079534820 11:21501171-21501193 TAAAATTCACTGAATTAACATGG - Intronic
1081658426 11:44873249-44873271 TGAAATTCCCTGAACTAACATGG - Intronic
1082323708 11:51110458-51110480 TAAACTTCCCAGAACTAACACGG + Intergenic
1082441417 11:52817726-52817748 TAAACTTCCCAGAACTACCAGGG + Intergenic
1082948156 11:58782197-58782219 TTAAATACCCTCAACAAACAAGG + Intergenic
1087237392 11:95735148-95735170 TGAAATAGCCAGAAATAACATGG - Intergenic
1091060358 11:132455345-132455367 TGAGATTCCCTTAACTCAAAAGG + Intronic
1091639828 12:2227917-2227939 TTAAATTCCCTGAACTCAAATGG + Intronic
1094792634 12:33932013-33932035 TGAAATTCCCCAATCTAGCAAGG + Intergenic
1095256970 12:40050072-40050094 TGAAATGCCCTCATCTAACTTGG + Intronic
1095998928 12:48113092-48113114 TAAAATGCCTTGACCTAACAAGG + Intronic
1099062640 12:77931497-77931519 TAAAATTCTCTGAAATAAAATGG - Intronic
1099173896 12:79398197-79398219 TGAGCTCCTCTGAACTAACAGGG + Intronic
1101828745 12:108240867-108240889 TTAACCTCCCTGAACTTACATGG + Intronic
1106657504 13:31761902-31761924 TGAAATACATTGAACTAAAACGG - Intronic
1107521234 13:41184014-41184036 TGAGATTATCTGAACTGACATGG + Intergenic
1109033078 13:57218926-57218948 CGAAATTCATTGAAGTAACAGGG + Intergenic
1109523183 13:63539733-63539755 TGCAATTCTCTGAACTCATAAGG + Intergenic
1110873143 13:80476134-80476156 TGAGATACCCTAAAATAACAAGG + Intergenic
1111066953 13:83106857-83106879 TGAAATTTGCTTAAGTAACAAGG + Intergenic
1112102831 13:96209178-96209200 TGTAATTCCTTGATCTTACAAGG + Intronic
1113980665 13:114272264-114272286 TCAAATTCCCTGAAATCCCACGG - Exonic
1115375968 14:32675698-32675720 GAAACTTCCCTGCACTAACAAGG - Intronic
1115973479 14:38971645-38971667 TGAAATTCCCTGAGCCTGCAGGG - Intergenic
1117422503 14:55560632-55560654 TCAAATTCCTTGAACAAAGAAGG - Intronic
1118036697 14:61875955-61875977 GGAAATTCCCCAACCTAACAAGG - Intergenic
1120634106 14:86929825-86929847 TGAATTACCCTGAACTCAGATGG - Intergenic
1121695492 14:95908870-95908892 TCCAATTCCCAGGACTAACAGGG - Intergenic
1125162099 15:36656628-36656650 TGCAAGTACCTGAACTAATAAGG + Intronic
1127306043 15:57706660-57706682 TGAAATTCCGGAAACAAACACGG - Exonic
1127782248 15:62327343-62327365 TGAAATTGCCTGAAACTACATGG - Intergenic
1129513324 15:76140602-76140624 TGAAAAGCCCTGAAATATCACGG - Intronic
1131411503 15:92211549-92211571 GGAAATTCCCTGAGTTATCATGG - Intergenic
1131743445 15:95419520-95419542 TGAAATTCCCTGTAATCTCATGG + Intergenic
1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG + Exonic
1137969645 16:52971874-52971896 TGAGATTCCCTGAACTCAATGGG - Intergenic
1138175372 16:54893208-54893230 TGACACTCCCTGTACTCACAGGG + Intergenic
1138960321 16:62021594-62021616 TGAAATTTCCTGCAAAAACAAGG + Exonic
1141370899 16:83485498-83485520 TGGAAGTCCCTAAAATAACACGG + Intronic
1144235428 17:13256276-13256298 TGACTTTCCCAGAACTTACAAGG + Intergenic
1145839829 17:27985008-27985030 TGAAATTCCAGGAAGGAACAAGG + Intergenic
1146896934 17:36549003-36549025 TCAAACTCACTGAACTACCATGG - Intronic
1147041589 17:37723383-37723405 TGAATTTCCTGTAACTAACAGGG - Intronic
1149644483 17:58229952-58229974 TCAAATTGGCTTAACTAACAAGG - Intronic
1150165812 17:62941322-62941344 AGAATTTCCCCAAACTAACAAGG + Intergenic
1154182764 18:12150960-12150982 TGAAATACCCTTCACTAAAAAGG + Intergenic
1155100350 18:22604776-22604798 TGAACTTTCCTGAACCAACTGGG - Intergenic
1156625525 18:38903032-38903054 TGAAATGCTGTGAAGTAACAGGG - Intergenic
1159126894 18:64234541-64234563 TGAAATTCACTGACATAACTGGG + Intergenic
1159191642 18:65052796-65052818 AGAAGTTTGCTGAACTAACAAGG - Intergenic
1161553928 19:4929751-4929773 TGACATTTCCTGATCTTACATGG - Intronic
1163230035 19:15995527-15995549 AGAAATTCACAGAAGTAACAAGG + Intergenic
1166774567 19:45304550-45304572 TGAAGTTCCCTGAACTTCCATGG - Intronic
1167707925 19:51092789-51092811 TGAAAATCCCTGCACTGTCAGGG - Intergenic
925305275 2:2843994-2844016 TGAAGTTTCCTAAACTAACTAGG - Intergenic
926758188 2:16252642-16252664 TGAAGATTCCTGTACTAACATGG + Intergenic
930478963 2:51922973-51922995 TGGAATTCCCTGAAGTATTAAGG + Intergenic
931020563 2:58040261-58040283 TGTATTTGCCTGAAATAACAAGG + Intronic
934852203 2:97708414-97708436 TGAAATCCCCTGTGCTATCAGGG - Intergenic
936434087 2:112488109-112488131 CGAAACTCCCTGAAGTGACAGGG - Intronic
939186085 2:138862363-138862385 TGAAATTCCATTTACTGACATGG - Intergenic
940040415 2:149354169-149354191 CAAAATGGCCTGAACTAACAGGG - Intronic
941624181 2:167812177-167812199 TCAAATTCCATGAGCTTACAAGG + Intergenic
942349647 2:175039165-175039187 TGGAATTCCATGAAATAAAACGG + Intergenic
944014261 2:195014731-195014753 TAAAATTCCCAGAACTATCTTGG + Intergenic
945691782 2:213045653-213045675 TGAAAGTCCCTGAACTTTCTTGG - Intronic
946794837 2:223339353-223339375 AGAAATTCCCAGAAATAACTAGG - Intergenic
949004154 2:241636335-241636357 TGAAATAGGCTGAACTCACAAGG + Intronic
1169302683 20:4457877-4457899 AGAAATTCCCTAAAATATCAAGG - Intergenic
1172912497 20:38420386-38420408 TGCAATGCCCTGAATTATCATGG + Intergenic
1176066162 20:63197078-63197100 TGAAATTCTCTGCACTCAGAGGG + Intronic
1176272162 20:64241038-64241060 TAAAATTCCTTGACCTGACAGGG - Exonic
1177135588 21:17302870-17302892 GGAAATTCCCTGAGTTATCATGG - Intergenic
1182159730 22:28109447-28109469 TGAAATTCCACTACCTAACAAGG - Intronic
950348224 3:12319730-12319752 TGAATTTCCCTGGAACAACATGG - Intronic
950674380 3:14545678-14545700 TGAAGTTGTCTGTACTAACAAGG + Intergenic
950794276 3:15497945-15497967 TGAACTTCTCTGAAAGAACATGG + Intronic
954231765 3:49223369-49223391 CGAAATTCCCTGAGTTATCATGG + Intronic
963256420 3:143149014-143149036 TGAAATTCCTTGAGCAAAAAAGG + Intergenic
963334734 3:143961586-143961608 AGAAACTCCCTGCACTTACAGGG + Intergenic
963682312 3:148393774-148393796 ACAAATTCCCTGAACTTAAATGG + Intergenic
969874658 4:10127140-10127162 GGAAATTGGCTGAACTAACAGGG + Intergenic
971028644 4:22612669-22612691 GGAAATTGCCTGAAGTCACATGG - Intergenic
973017604 4:45160757-45160779 TGAAATTTTCTGAACTGTCAAGG + Intergenic
973549222 4:52015047-52015069 TGAATTCCCCTGAGCTAACTGGG - Intronic
975392568 4:73836575-73836597 GGAAATTCCCTGAACTCAGGGGG - Exonic
975406718 4:73998759-73998781 GGAAATTCCCTGAACTCATGGGG + Exonic
975470945 4:74766943-74766965 TGTAAAGCCCTTAACTAACATGG + Intronic
979086728 4:116421358-116421380 TAAAATTCCCTGAATTAAAATGG + Intergenic
979101709 4:116624900-116624922 TTAATTTCACTGAAGTAACAGGG - Intergenic
981415138 4:144484044-144484066 GGAAATTCCCTAACCTAGCAAGG + Intergenic
982035582 4:151342727-151342749 TGAAATCCCCTGAAGAGACAAGG - Intergenic
982178657 4:152729834-152729856 TGAAAGTCCCAGCACTCACATGG - Intronic
983582118 4:169319282-169319304 AGAACTTCCCTGACCTAGCAAGG + Intergenic
987159471 5:15126206-15126228 ACAAAATCCCTGAACTCACAGGG - Intergenic
989324494 5:40175377-40175399 TAAAATTCCATGACTTAACATGG - Intergenic
989453264 5:41611975-41611997 ATAAATTTCCTGAGCTAACATGG + Intergenic
990124464 5:52497220-52497242 TGAAAGTCCCCGAACTTCCAAGG + Intergenic
990752663 5:59034946-59034968 TGAACCTCACTGAACTTACAGGG + Intronic
991311485 5:65247943-65247965 TCAAACTCCCTCAACAAACAGGG - Intronic
994231218 5:97312230-97312252 CGAAATTCCCTGAGTTATCATGG + Intergenic
996788750 5:127269682-127269704 AGAAATTCCCCGATCTAGCAAGG + Intergenic
998111985 5:139509378-139509400 TGGAATTCCCTGAGTTATCATGG - Intergenic
998992295 5:147831299-147831321 AGAAATTCCCAGAAATAAAATGG - Intronic
1003294563 6:4813492-4813514 AGTAAGTCCCTGAAATAACAGGG - Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1003725723 6:8760871-8760893 TGAAATTTTCTGAAATTACATGG + Intergenic
1007064861 6:38979975-38979997 AGAAATTCCAAGAACTAAAACGG + Intronic
1008662275 6:53680443-53680465 TAAAATTCTCTGAACAAAGAAGG + Intergenic
1008958883 6:57245487-57245509 TGCAGTTCCCTGAGCTAACTTGG - Intergenic
1010083798 6:71892357-71892379 TGAAATTCCCAGAACTAGCTTGG + Intronic
1010884769 6:81222758-81222780 TGGCATTCCCTGAGTTAACAAGG - Intergenic
1011376579 6:86693929-86693951 AGAACTTCCCTGATCTAGCAAGG - Intergenic
1011810413 6:91126116-91126138 TGCAAATCCCTGAAATAAAATGG - Intergenic
1012570868 6:100726714-100726736 TTCAGTTCCCTGAACTAAAATGG + Intronic
1012952295 6:105531095-105531117 TCAAATTCCTTGAAAAAACATGG + Intergenic
1014593418 6:123301635-123301657 TAAATGTCCTTGAACTAACATGG + Intronic
1015583493 6:134751632-134751654 TGAAATTCACTGAAAAAATATGG + Intergenic
1015689596 6:135907003-135907025 TGAAAATCTCTGAAATGACATGG + Intronic
1015698781 6:136011677-136011699 TCTAAGTGCCTGAACTAACATGG + Intronic
1017061115 6:150485850-150485872 TTAAATTCCTTGAACTCACAAGG + Intergenic
1018301006 6:162403157-162403179 TGAAATTCTTTCAACTCACAAGG + Intronic
1021514215 7:21465230-21465252 TGAAACTCCCTGAGCTAGGAAGG - Intronic
1021726347 7:23551190-23551212 TGAAATTCACTGAAGTAAAAGGG + Intergenic
1022432721 7:30342291-30342313 AGAAATTGCATCAACTAACAGGG - Intronic
1022797987 7:33748114-33748136 AGAAGTTCCCGGAACTGACAAGG - Intergenic
1022879284 7:34569062-34569084 TTAAATTTCCTGAAGTAATAGGG - Intergenic
1025123664 7:56328085-56328107 TGAAGGTCACTGAACCAACAGGG - Intergenic
1026253144 7:68688441-68688463 TGTAATTCCCCCAATTAACAAGG + Intergenic
1027791541 7:82642521-82642543 GGAAATTCCCTGAGTTATCATGG - Intergenic
1027941657 7:84690052-84690074 TGAAATTCCATCAACTCACTAGG + Intergenic
1033203443 7:139394770-139394792 TGAAATAACCGGAACTAGCATGG + Intronic
1035263822 7:157677848-157677870 AGAACTTCCCTGGACTAACTAGG - Intronic
1035525994 8:313780-313802 TGGAAATCCCTGAAAAAACATGG + Intergenic
1039256427 8:35723962-35723984 TGAAATCACCTGGAATAACATGG + Intronic
1041002423 8:53465636-53465658 GGAAATTCCCTGAGTTATCATGG - Intergenic
1041841990 8:62282625-62282647 TGAAATTACCTGATAAAACAGGG + Intronic
1042308571 8:67357486-67357508 AGAACTTCCCTAAACTAGCAAGG - Intergenic
1042341308 8:67683006-67683028 TGAAAGTCCAAGAACTTACAAGG - Intronic
1042437231 8:68781179-68781201 TGAAATACACTGAACTTTCAGGG + Intronic
1042920117 8:73912044-73912066 GGAAATTCCCTGAGTTATCATGG - Intergenic
1044408894 8:91863232-91863254 CCTAATTCCCTGAACTAACATGG + Intergenic
1045046529 8:98284297-98284319 TTAAACTTCCAGAACTAACATGG - Intronic
1046904114 8:119553988-119554010 TGAAAATCCCTGAATGGACAGGG - Intergenic
1051124557 9:13789704-13789726 TCAAATTCCCTAAACTAACTGGG - Intergenic
1053882254 9:42607848-42607870 TGAACTTCCCTGAAGCAAAAAGG + Intergenic
1053890414 9:42686445-42686467 TGAACTTCCCTGAAGCAAAAAGG - Intergenic
1054221279 9:62415317-62415339 TGAACTTCCCTGAAGCAAAAAGG + Intergenic
1054229435 9:62493856-62493878 TGAACTTCCCTGAAGCAAAAAGG - Intergenic
1054456971 9:65436947-65436969 TGAAATGCCCTGAAACAAAATGG + Intergenic
1056677983 9:88692700-88692722 TGAAACTACATGAACAAACATGG + Intergenic
1060073510 9:120571220-120571242 GGAAAATCCCTTAACTTACAGGG - Intronic
1185813260 X:3130039-3130061 TAAAATTCCCAGAAATACCAAGG - Intergenic
1186400207 X:9251078-9251100 TCAAATTCCCTCAGCTAAGACGG - Intergenic
1189211166 X:39284771-39284793 TGTAATTCCCTGAACTTTCTAGG + Intergenic
1189704633 X:43747740-43747762 GGAAGTTCCCTTACCTAACAGGG - Intergenic
1193001693 X:76569630-76569652 TGAACTTCCCTAACCTAGCAAGG + Intergenic
1195022954 X:100847827-100847849 TGAGATTCCCTGAACAAGTAGGG - Intronic
1195378756 X:104251963-104251985 TAAAATTCCCTTACCTAAGAAGG - Intronic
1195724238 X:107897616-107897638 TGAAACTTCCTGATATAACAGGG + Intronic
1196411787 X:115427559-115427581 TGAAATTTCATGGACTAACTTGG + Intergenic
1196951599 X:120930895-120930917 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196952283 X:120935756-120935778 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196952968 X:120940617-120940639 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196953653 X:120945477-120945499 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196954338 X:120950338-120950360 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196955021 X:120955198-120955220 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196955709 X:120960081-120960103 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196956390 X:120964942-120964964 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196957072 X:120969802-120969824 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196957754 X:120974662-120974684 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196958436 X:120979522-120979544 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196959117 X:120984382-120984404 TGAAAAGCCATGAACTAAAAGGG + Intronic
1198420893 X:136470081-136470103 GAAAATTCCCTGAACTCCCAGGG - Intergenic
1199789411 X:151137994-151138016 TTAAATTCCTTGAACTATCTGGG + Intergenic
1201311590 Y:12602666-12602688 GGAAATTCCCTGAGTTATCATGG + Intergenic
1201404233 Y:13633937-13633959 GGAAATTCCCTGAGCTATCATGG - Intergenic
1201455595 Y:14164303-14164325 GGAAATTCCCTGAGTTATCATGG - Intergenic
1201472735 Y:14351873-14351895 GGAAATTCCCTGAATTACCATGG + Intergenic
1201724729 Y:17139659-17139681 TAAAATGCCTTGACCTAACAAGG + Intergenic
1201907832 Y:19103510-19103532 GGAAATTCCCTGAGTTATCATGG + Intergenic
1201911471 Y:19137496-19137518 GGAAATTCCCTGAGTTATCATGG - Intergenic
1202344241 Y:23904924-23904946 AGAACTTCCCTGACCTAGCAAGG - Intergenic
1202526527 Y:25765159-25765181 AGAACTTCCCTGACCTAGCAAGG + Intergenic