ID: 1081659487

View in Genome Browser
Species Human (GRCh38)
Location 11:44879267-44879289
Sequence TAGGGAAAGAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2546
Summary {0: 1, 1: 3, 2: 17, 3: 296, 4: 2229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081659487_1081659494 6 Left 1081659487 11:44879267-44879289 CCTTCCTCCTTCTTCTTTCCCTA 0: 1
1: 3
2: 17
3: 296
4: 2229
Right 1081659494 11:44879296-44879318 CATTGAGCACTCAGTATACTGGG 0: 1
1: 0
2: 2
3: 9
4: 149
1081659487_1081659493 5 Left 1081659487 11:44879267-44879289 CCTTCCTCCTTCTTCTTTCCCTA 0: 1
1: 3
2: 17
3: 296
4: 2229
Right 1081659493 11:44879295-44879317 CCATTGAGCACTCAGTATACTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081659487 Original CRISPR TAGGGAAAGAAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr