ID: 1081662191

View in Genome Browser
Species Human (GRCh38)
Location 11:44894908-44894930
Sequence GGTTTGGGGTCCAGCTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081662184_1081662191 7 Left 1081662184 11:44894878-44894900 CCCACGGATAGGTGTCGTATCAG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1081662191 11:44894908-44894930 GGTTTGGGGTCCAGCTGACTTGG 0: 1
1: 0
2: 4
3: 13
4: 169
1081662183_1081662191 8 Left 1081662183 11:44894877-44894899 CCCCACGGATAGGTGTCGTATCA 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1081662191 11:44894908-44894930 GGTTTGGGGTCCAGCTGACTTGG 0: 1
1: 0
2: 4
3: 13
4: 169
1081662185_1081662191 6 Left 1081662185 11:44894879-44894901 CCACGGATAGGTGTCGTATCAGG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1081662191 11:44894908-44894930 GGTTTGGGGTCCAGCTGACTTGG 0: 1
1: 0
2: 4
3: 13
4: 169
1081662182_1081662191 13 Left 1081662182 11:44894872-44894894 CCACACCCCACGGATAGGTGTCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1081662191 11:44894908-44894930 GGTTTGGGGTCCAGCTGACTTGG 0: 1
1: 0
2: 4
3: 13
4: 169
1081662179_1081662191 26 Left 1081662179 11:44894859-44894881 CCTGTCTCTGGTGCCACACCCCA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 1081662191 11:44894908-44894930 GGTTTGGGGTCCAGCTGACTTGG 0: 1
1: 0
2: 4
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081662191 Original CRISPR GGTTTGGGGTCCAGCTGACT TGG Intronic
903673743 1:25051735-25051757 GGTTTGGAGTCGGGCTGTCTGGG + Intergenic
904854749 1:33489329-33489351 TGTTTGGGGCCCAGCAGGCTGGG - Intronic
904974159 1:34443032-34443054 GGTATGGGGTAGAGCTGACAAGG - Intergenic
905061477 1:35143326-35143348 GTTTGGGGGTGCACCTGACTCGG + Intergenic
907704190 1:56818990-56819012 GGTCAGGAGTCCAGCTGGCTGGG + Intronic
907763986 1:57390007-57390029 GGTTTGGGGGCCAGGTGGCCTGG - Intronic
908161798 1:61416804-61416826 GCTTTGGAGTCCAGCAGACTGGG - Intronic
909918753 1:81354096-81354118 ACTTTGGAGTCCAGCAGACTTGG + Intronic
910493768 1:87802468-87802490 GGTTTGTTTTCCAGCAGACTGGG + Intergenic
913319420 1:117577955-117577977 GGCTTGGTGTCCTGCTGCCTGGG - Intergenic
916102821 1:161407231-161407253 TGTTGGGGGTGCACCTGACTCGG + Intergenic
920940741 1:210479885-210479907 GCTTTGGAGTCCAGCAGACTCGG + Intronic
923037624 1:230295674-230295696 GGTTCGGGGCCCAGCTGGCATGG - Intergenic
923549903 1:234955282-234955304 GGCTTGGGCTCCATCTGCCTCGG + Intergenic
1064358114 10:14638086-14638108 GGTTTGGTGACCATCTGAGTTGG - Intronic
1064757659 10:18586512-18586534 GGTTCGTGGTCTTGCTGACTTGG + Intronic
1065057096 10:21857182-21857204 GGTTTGGGGGCCATTTTACTTGG + Intronic
1067167005 10:43873426-43873448 GGTTTGATATCCATCTGACTTGG - Intergenic
1067701755 10:48578264-48578286 GGTTTGGGATTTAGCTGTCTTGG + Intronic
1067797859 10:49333782-49333804 GGTTTGGGGCCTAACTGAATTGG - Intergenic
1072477864 10:95780732-95780754 GGTGTGGGGTCCAGCTGTAGGGG + Intronic
1072526437 10:96275985-96276007 GGCTGGGGCTCCATCTGACTTGG + Intergenic
1072786741 10:98288467-98288489 GGTTTGGTGTACAGATTACTTGG - Intergenic
1075191908 10:120316883-120316905 GGTTTGGTGTGCAGGTGACCAGG - Intergenic
1076658168 10:132037800-132037822 GGTTTGGGCTTCAGTTGCCTGGG + Intergenic
1076704479 10:132293755-132293777 GGTGGGAGGTCCAGCAGACTGGG + Intronic
1077421247 11:2451030-2451052 GGTGTGGGGTCCATCTGAGCAGG + Intronic
1077648173 11:3945066-3945088 GCTTTGGAGTCAAGCTGCCTGGG + Intronic
1078358012 11:10647223-10647245 GCTTTGGGGTCAGGCTGCCTGGG + Intronic
1081662191 11:44894908-44894930 GGTTTGGGGTCCAGCTGACTTGG + Intronic
1084934795 11:72581123-72581145 GGTTTGGAGCCCAGCAGACCCGG + Intronic
1085484683 11:76851986-76852008 GGCTTGGGGTCCAGCTGCTGGGG + Intergenic
1085505537 11:77056613-77056635 GGGTTGGGGCACAGCTGTCTGGG + Intergenic
1086303368 11:85453853-85453875 GGTTTGGTGTCCAGATTATTTGG + Intronic
1089192375 11:116662211-116662233 ACTTTGGGGTCCTGCAGACTTGG + Intergenic
1089746482 11:120620998-120621020 GTTTTGGAGTCAGGCTGACTTGG - Intronic
1090914133 11:131148027-131148049 GGTTTGGGTTTCTGTTGACTTGG + Intergenic
1091741260 12:2961545-2961567 GGTTTGGGGTCAGGCAGACCAGG + Intronic
1092749119 12:11702030-11702052 GGATTGGGGTACAGGTAACTTGG + Intronic
1096924335 12:55125471-55125493 GGTTTGTGGTCTCGCTGACTTGG - Intergenic
1102581233 12:113889402-113889424 GGTTTGGGGCTGAGCTGAGTTGG - Intronic
1104688614 12:130807390-130807412 GCTCTGGGGTCCACCTGCCTGGG - Intronic
1105470772 13:20692767-20692789 GGTTTGGGATCCAGCAGTGTGGG + Intergenic
1113114152 13:106857181-106857203 GGTTCAGGGCCCAGCTGACTTGG + Intergenic
1116734465 14:48671263-48671285 GGTTTGGGTTCCAGCTGTGCTGG - Intergenic
1118718230 14:68575442-68575464 GGTTTGGGGTCTGGCTGATTTGG + Intronic
1119260114 14:73233075-73233097 GGCGTGGGCTCCAGCTCACTAGG - Intergenic
1120706530 14:87751650-87751672 GGTTTGGAGTCAACCTGCCTGGG + Intergenic
1122117529 14:99535337-99535359 GTGTTGGGGGCCAGCTGGCTTGG - Intronic
1122971513 14:105154149-105154171 AGTTTGGGAACCAGCTGAGTTGG - Intronic
1125899481 15:43331543-43331565 GTTTTGGAGTCCAGCAGATTTGG + Intronic
1128751541 15:70153886-70153908 ATTTTGGAGTCCAGCAGACTTGG - Intergenic
1129420819 15:75424704-75424726 GGTATGGAGTCCACCTGCCTTGG + Intronic
1131261611 15:90890762-90890784 GGTTTGGGGTCTTCCTGCCTGGG + Intronic
1132147567 15:99437624-99437646 GGATTGGGGCCCAGCACACTGGG + Intergenic
1132678496 16:1130410-1130432 GGTCTGGGGTCCATCTGGCGAGG + Intergenic
1133846294 16:9457085-9457107 GGTTTTGGGATCAGCTGACAAGG - Intergenic
1134456592 16:14399799-14399821 GGTGTTGGGGCCAGCAGACTAGG + Intergenic
1134668706 16:16038677-16038699 TGTTAGGGGTCAAGTTGACTGGG - Intronic
1136298264 16:29316174-29316196 GGTTTGGAGGCCAGATGCCTAGG + Intergenic
1137737205 16:50733768-50733790 GGTTTTGCGTCTGGCTGACTCGG + Intergenic
1141627704 16:85270038-85270060 GGGGTGGAGTCCAGCAGACTTGG - Intergenic
1142059919 16:88022679-88022701 GGTTTGGAGGCCAGATGCCTGGG + Intronic
1142353543 16:89590747-89590769 GGTCGGGGGAGCAGCTGACTGGG + Intronic
1143886821 17:10071136-10071158 TTTTTGGGGTCCTGCTGGCTGGG - Intronic
1146278655 17:31531134-31531156 GGGTTGGGGCCCAGCTCACCTGG - Intronic
1146453097 17:32990445-32990467 GCTTTGGGGTCAGGCTGACCAGG - Intronic
1147020583 17:37529242-37529264 GGTTTGGGGCCCATCTAACCTGG - Intronic
1148326859 17:46788384-46788406 GGTGTGGGAACCAGCAGACTTGG - Intronic
1149536273 17:57435978-57436000 GTTTTGTGGTCCAGCAGACCTGG - Intronic
1149596047 17:57865339-57865361 GGTGTGGGGGCCAGCTGCCCAGG + Intronic
1149661139 17:58334503-58334525 GGTTTGAGGCCCAGCAGAGTCGG - Intergenic
1152030225 17:77837773-77837795 GGTTTGGAGTCTAGCAGACCTGG + Intergenic
1152096520 17:78275366-78275388 GGGTTGGGGTCCAGGGGAATGGG - Intergenic
1152136611 17:78507554-78507576 GGTTTGAGGTCCAGCGAACCTGG - Exonic
1152546021 17:81000450-81000472 GGTTTGGGGTCCTGGTGCCCAGG + Intronic
1152946331 17:83199443-83199465 GGTTTGGGCTCAGGCTGACCGGG - Intergenic
1153279746 18:3403485-3403507 GCTTTGGGGTCCAGCAGAAATGG + Intergenic
1154355742 18:13622181-13622203 GGTATGGGGTGCAGCTGTCCAGG + Intronic
1154490655 18:14919550-14919572 TGATTGTGGGCCAGCTGACTTGG - Intergenic
1155290443 18:24335700-24335722 GGTTGGGGAGCCAGGTGACTGGG + Intronic
1157067895 18:44373648-44373670 GGGTTGGAGTCCAGCTGAGATGG - Intergenic
1161249251 19:3271394-3271416 GGAAAGGGGTCCAGCTGGCTGGG + Intronic
1161399932 19:4062738-4062760 GGGCTGGAGTCCAGCTGACATGG + Intronic
1162387444 19:10368347-10368369 GGTTTGGGGGCAACCAGACTTGG + Exonic
1162403742 19:10461387-10461409 GGGCTGGGGTAGAGCTGACTGGG + Intronic
1163421765 19:17217486-17217508 GACTTGAGGGCCAGCTGACTAGG + Intronic
1163598014 19:18231691-18231713 GGATGCTGGTCCAGCTGACTTGG + Intronic
1164853918 19:31505849-31505871 GCTTTGGGCTCTAGCTGCCTGGG - Intergenic
1168494306 19:56837387-56837409 GATTTGGGGTCTAGGTGATTTGG - Intronic
929747738 2:44676473-44676495 GGTTTAGGGTCCAGATGACTGGG - Intronic
929908990 2:46072940-46072962 GGTTTGGGAACCAGCAGATTAGG - Intronic
935550858 2:104452208-104452230 GCTTTGGGGTCAGGCTGACTTGG - Intergenic
936248090 2:110846034-110846056 GGTTTGGGGTCAACATGACAAGG - Intronic
936675704 2:114711408-114711430 GGTTCAGGATCCAGCTGCCTGGG + Intronic
937288061 2:120765517-120765539 GGCTTTGTGCCCAGCTGACTGGG + Intronic
940424337 2:153513703-153513725 GGTTTGGGATCTAGCTGAACTGG + Intergenic
944489897 2:200247784-200247806 GGTATGGGTTCCAGCTGGCTAGG + Intergenic
945671577 2:212808575-212808597 GCTTTGGGATCTAGCTGCCTGGG + Intergenic
946191101 2:218008417-218008439 AGTCTGGGGTCCAACTGACCTGG + Intergenic
946417596 2:219548133-219548155 GGGTTGGGGGCCAAGTGACTGGG + Intronic
946843006 2:223836791-223836813 GGTTTTGGTTCCAACTGAGTAGG - Intronic
1173235278 20:41239584-41239606 GGTGTGGGGTTTACCTGACTGGG + Intronic
1173445792 20:43116950-43116972 TGTCTGGGGTCAAGCTGACCAGG + Intronic
1175381975 20:58569722-58569744 GGGTTGGGGGCCCTCTGACTCGG + Intergenic
1178492051 21:33058674-33058696 GGGCTGGGTTCCAGCTGGCTGGG - Intergenic
1179990040 21:44943153-44943175 GGTTTGGTCGGCAGCTGACTTGG + Intronic
1180197044 21:46203157-46203179 GGCTTGGGGTCCACCTGCCTGGG - Intronic
1182470243 22:30544012-30544034 GGCTTGGGGGCCAGCTGCTTGGG - Intronic
1184602661 22:45552763-45552785 GGTTTGCGGCCCAGCTTCCTGGG - Intronic
950264722 3:11565172-11565194 GCTTTGGTGTCCGGCTGACCCGG - Intronic
950686350 3:14621317-14621339 GTTCTGGGGTCAAGCTGCCTGGG - Intergenic
952883319 3:37998598-37998620 GGTCTGGGGCCCTACTGACTGGG + Intronic
952946335 3:38479950-38479972 GGTTTTGTGCCCAGCTGCCTCGG - Intronic
952955104 3:38551960-38551982 GGTTTGAGGACCAGCAGCCTTGG + Intronic
953701821 3:45201915-45201937 GGCTTGGGATCAAGATGACTTGG + Intergenic
955057661 3:55471022-55471044 GGCTTGGAGTCCAGCTGCCTGGG - Intronic
958072625 3:88633943-88633965 GGTTTGGGGGTCACCTGATTTGG + Intergenic
963254098 3:143127569-143127591 AGTTTGGGGTCCTTCTGAGTGGG + Intergenic
964893950 3:161571625-161571647 GGTTTGGTGTACAGATGATTTGG + Intergenic
966941331 3:184749799-184749821 GCTCTGGGGTCCGGCAGACTTGG - Intergenic
967439550 3:189490937-189490959 GGTTTAGGGTGCGGCTGGCTTGG + Intergenic
968444918 4:647330-647352 GATTTGGGGTCCATCTGGCCGGG + Intronic
968903524 4:3441846-3441868 GGTGTGGGGGCCAGGGGACTCGG + Intergenic
969890524 4:10255744-10255766 GGGTTGTGGACCAGCTCACTGGG + Intergenic
972939343 4:44178049-44178071 GGTTTGGGGTCCTACTGACTTGG + Intronic
973271490 4:48267597-48267619 GTCTTGGGGGCCAGCTGCCTTGG - Intronic
975430981 4:74290416-74290438 GCTTTGGAGTCAAGCTAACTTGG + Intronic
981372544 4:143975637-143975659 AGTTGGGGGTCTAGGTGACTTGG + Intergenic
981452679 4:144916766-144916788 GGTTTTGGGACAAGCTGATTTGG + Intergenic
982205043 4:152991416-152991438 GTTTGGGGTTCCAACTGACTTGG - Intergenic
984192152 4:176619006-176619028 AGTTTGGGGTCAAACTGTCTTGG + Intergenic
984947731 4:184983088-184983110 GGTTTGGGGACCAGCTGGCTGGG - Intergenic
987149724 5:15026684-15026706 GGTTTGGGAGCAAGCTGTCTGGG - Intergenic
987381544 5:17290075-17290097 GGTTTGAGGGCCAGCCTACTAGG - Intergenic
988060108 5:26156050-26156072 GGTTTAAGGTTAAGCTGACTAGG - Intergenic
988391534 5:30640091-30640113 GGTTTTGAGTTCTGCTGACTGGG - Intergenic
988733994 5:34002550-34002572 GCTTTAGGGTCCAACTGCCTGGG + Intronic
991527531 5:67578230-67578252 GGCTTAGGGTCCATCTGATTTGG - Intergenic
992876999 5:81066428-81066450 GGTTTGAGGTTTAGCTTACTTGG - Intronic
1001515671 5:172353832-172353854 GGTTTGGGGTCACGCTGGGTGGG - Intronic
1001573936 5:172749580-172749602 GCTTTCGGCTCCAGCAGACTGGG - Intergenic
1003457915 6:6300650-6300672 GGTATGGGGTTCATCTCACTAGG - Intronic
1004343268 6:14826138-14826160 GGTTTGGGGGGAAGCTCACTGGG - Intergenic
1007397195 6:41584725-41584747 GGGTTGGGGTCCAGGGGACAGGG + Intronic
1007508222 6:42354122-42354144 GGGTTTGGATCCAGCTGCCTTGG + Intronic
1007663552 6:43501186-43501208 GGCTTGGTGGCCAGCTGACATGG + Intronic
1011037592 6:82994762-82994784 GGTTTTGAGTCCAGGTGACTAGG + Intronic
1015647548 6:135410491-135410513 GCTCTGGGGTCCAGCTGCTTAGG - Intronic
1015948689 6:138529524-138529546 GGTTAGCAGTCCAGCAGACTTGG + Intronic
1016686557 6:146888876-146888898 GAAGTGGGGGCCAGCTGACTGGG - Intergenic
1017859522 6:158382520-158382542 ACTTTGGAGTCCAGCAGACTGGG + Intronic
1018240193 6:161766782-161766804 GGTTTAGGGGCCAGCAGACAAGG + Intronic
1018278502 6:162158793-162158815 GGTTTGTGGTCCATGTTACTTGG + Intronic
1020938789 7:14504292-14504314 GGTTTGGATACCAGCTGGCTTGG + Intronic
1023639450 7:42242758-42242780 GGTGTGGGGACAAGGTGACTAGG - Intergenic
1023882403 7:44327817-44327839 AGTGTGGGGTCAAGCTGTCTGGG - Intronic
1024058575 7:45682021-45682043 GGCTTGGGCTCCAGTTGTCTGGG + Intronic
1024244529 7:47459251-47459273 GCTTTGGGGTCCACATCACTAGG + Intronic
1026788481 7:73316907-73316929 GGTTTGGGGACCAGCAGTGTTGG + Intronic
1027905469 7:84175112-84175134 GGTTTGGTGTCCAACGGACATGG + Intronic
1032192188 7:129771604-129771626 GGCTGGGGGAGCAGCTGACTTGG + Intergenic
1033238971 7:139661292-139661314 GGTTTGGTGTACAGCTGTCAGGG - Intronic
1033428011 7:141263070-141263092 GGTTTAGTGTCCAGATAACTGGG - Intronic
1033668357 7:143465160-143465182 GGTTTGGGGTCCAGTTGAACAGG - Intergenic
1037639614 8:20730778-20730800 GGCTTGGGGACCAGCTGCCAGGG - Intergenic
1038504812 8:28075183-28075205 GCTTTGGGGGGCTGCTGACTGGG + Intronic
1041247137 8:55899327-55899349 GTTTAGGGGTCCGGCTGACTTGG - Intronic
1041390658 8:57344569-57344591 GGTTTGATGTCAAGCTGACCAGG - Intergenic
1045502760 8:102755966-102755988 GGAGTGGGGACCAGCAGACTGGG - Intergenic
1047525105 8:125626299-125626321 GGTGTGGTGTTCAGCTAACTGGG + Intergenic
1047932933 8:129748846-129748868 GCTTTGGGATCCAGCGGACCAGG + Intronic
1049579806 8:143406203-143406225 GGGCTGGGGTGCAGCTGTCTTGG - Intergenic
1051561407 9:18445044-18445066 GCTTTGGAGTTCAACTGACTGGG - Intergenic
1051735195 9:20190660-20190682 GGTTTGGAGTCCAACAGACCAGG - Intergenic
1053098464 9:35349453-35349475 GGCTTGGTGCCCAGCTGCCTAGG - Intronic
1053270665 9:36747256-36747278 GCTTTGGGGTCCAGCTGACCTGG + Intergenic
1056068930 9:82965798-82965820 GGTGTGGAGTCCAGTTGACTGGG - Intergenic
1059433999 9:114265641-114265663 GGTTTGAGGCTCAGCTCACTTGG + Intronic
1061948484 9:133922055-133922077 GGCTTGGGGTCCAGCAGGCGGGG - Intronic
1062194349 9:135264692-135264714 GGTTTGGGTTCGAGCTTGCTGGG - Intergenic
1186201061 X:7155368-7155390 TGTTTGGTGTCACGCTGACTTGG - Intergenic
1191266243 X:58397117-58397139 GGTATGAGGTCCATCTCACTAGG - Intergenic
1194100175 X:89693995-89694017 GGGTTGGGTTCCAGCTGCATTGG + Intergenic
1195159053 X:102154133-102154155 GGTTTGGGCTCCACCTGCCCCGG - Exonic
1195881929 X:109601484-109601506 GGTTTGGGGGACAGCAGTCTTGG + Intergenic
1200453174 Y:3355354-3355376 GGGTTGGGTTCCAGCTGCATTGG + Intergenic