ID: 1081667483

View in Genome Browser
Species Human (GRCh38)
Location 11:44925047-44925069
Sequence GAGCCCTAAGGGCAACCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081667483_1081667492 5 Left 1081667483 11:44925047-44925069 CCCCTGGGTTGCCCTTAGGGCTC 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1081667492 11:44925075-44925097 CAGTCATACAGCCCTTAACTGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1081667483_1081667491 4 Left 1081667483 11:44925047-44925069 CCCCTGGGTTGCCCTTAGGGCTC 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1081667491 11:44925074-44925096 CCAGTCATACAGCCCTTAACTGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081667483 Original CRISPR GAGCCCTAAGGGCAACCCAG GGG (reversed) Intronic
900326847 1:2112469-2112491 GACCCCTCAGTCCAACCCAGAGG + Intronic
900635510 1:3662954-3662976 GTGCCCAAAGGGCAACACATGGG - Intronic
900806801 1:4772834-4772856 GAGCCCAAAGGCCAGCCCCGTGG + Intronic
900944428 1:5821918-5821940 GATCCCTAAGGGATACCAAGGGG + Intergenic
901068022 1:6503885-6503907 GAGCCGTGAGGGCATCCCAAGGG + Intronic
902622884 1:17660625-17660647 GACCCCTGAGGGAGACCCAGGGG + Intronic
903449146 1:23441233-23441255 GAGACCTCAGGGCATCTCAGTGG + Intronic
905797358 1:40823203-40823225 CAGCCCTAGGGGCTTCCCAGGGG + Intronic
906297882 1:44660130-44660152 CAGCCCTCACGGCAGCCCAGGGG + Intronic
907935784 1:59041039-59041061 GAGCCACAGGGGCACCCCAGAGG - Intergenic
911144168 1:94536456-94536478 GAGTCCTCATAGCAACCCAGGGG + Intronic
912421297 1:109543943-109543965 GAGCACTCAGGGCAACATAGAGG - Exonic
912860966 1:113213559-113213581 GAGCCTTCAGGACAACACAGAGG - Intergenic
914244097 1:145873041-145873063 GAGCCCTAAAGGCAGCCCCAGGG - Exonic
915579516 1:156805053-156805075 GAGCCCTGAGGATAATCCAGGGG + Intergenic
917634400 1:176920663-176920685 GAGCCCTCAGCGGAACCCATGGG - Intronic
922134941 1:222815269-222815291 GAGCCCTAAGGGCAGCCTTTAGG + Intergenic
922921790 1:229311559-229311581 AAGGCCTGAGGGCAACGCAGGGG + Intergenic
924643156 1:245852590-245852612 GAGGCCTAAGCGCAAGTCAGTGG + Intronic
1069070733 10:63988363-63988385 GTGTCCTAAGGGCAACCTGGAGG - Intergenic
1074188750 10:111117736-111117758 GAGGTCTAAGGGCAACCCCGAGG + Intergenic
1075597629 10:123743700-123743722 GAGCCCTCAGGGCCTCTCAGAGG - Intronic
1075641711 10:124069523-124069545 GAGCCTCAAAGGCAACACAGGGG + Intronic
1076300607 10:129423159-129423181 AAGCCCTAAGGGCCACTCATGGG + Intergenic
1076504469 10:130962778-130962800 GAGCTCCCAGGGCAGCCCAGAGG + Intergenic
1077325804 11:1963526-1963548 GTGCCCTCAGGGGAACTCAGAGG - Intronic
1077393194 11:2309153-2309175 AACCCCTAAGGCCAAGCCAGTGG - Intronic
1077440033 11:2563976-2563998 GGGCCTTCAGGGCCACCCAGCGG - Intronic
1077992239 11:7422391-7422413 GATCCCTAAGGGAGACCCACAGG + Intronic
1080909056 11:36576479-36576501 AAGCCCTCAATGCAACCCAGAGG - Exonic
1081365683 11:42232191-42232213 GTTCTCTAAGGGGAACCCAGGGG + Intergenic
1081667483 11:44925047-44925069 GAGCCCTAAGGGCAACCCAGGGG - Intronic
1083375134 11:62214293-62214315 GAGGCCCAAAGACAACCCAGAGG - Intergenic
1085329370 11:75635138-75635160 GAGTCCCCAGGGGAACCCAGAGG - Intronic
1088368082 11:109059896-109059918 GAGGAGTGAGGGCAACCCAGAGG + Intergenic
1088927333 11:114315694-114315716 GAGCCCAAAGAACAGCCCAGTGG - Intergenic
1202808784 11_KI270721v1_random:18705-18727 GTGCCCTCAGGGGAACTCAGAGG - Intergenic
1093555754 12:20471528-20471550 GAGATGTAAGGGGAACCCAGAGG - Intronic
1114664811 14:24371267-24371289 TTGCCCTATGGGAAACCCAGGGG - Intronic
1123204054 14:106694818-106694840 GAGCCCTCAGGGCCACCAGGAGG - Intergenic
1123209071 14:106741307-106741329 GAGCCCTCAGGGCCACCAGGAGG - Intergenic
1124604386 15:31160074-31160096 GAGCCCTCAGGGCATGCAAGTGG + Intronic
1127396809 15:58549808-58549830 CAGCCCTAAGGGACAGCCAGTGG - Intronic
1130948453 15:88567204-88567226 GAGGCCCTATGGCAACCCAGGGG - Intergenic
1131671644 15:94626149-94626171 CAGACCTCAGGGCCACCCAGAGG - Intergenic
1136186425 16:28591275-28591297 GAGGACTGAGGGCAACCCAGAGG - Intronic
1137445641 16:48530270-48530292 GAGCCCTCAGAGCAACACATGGG - Intergenic
1139344969 16:66296896-66296918 GAGTCCTGAGAGCACCCCAGGGG - Intergenic
1143285301 17:5784731-5784753 GAGCCCTACAGGGAACACAGAGG - Intronic
1143457400 17:7077078-7077100 GGGTCCTCACGGCAACCCAGTGG + Intronic
1144506603 17:15836840-15836862 GAGCCATCAGAGCAACACAGAGG - Intergenic
1145118677 17:20235988-20236010 GAGCCATCAGAGCAACACAGAGG - Intronic
1145170779 17:20654776-20654798 GAGCCATCAGAGCAACACAGAGG - Intergenic
1147164834 17:38587553-38587575 GAGCCCAAAGTGGAACCCAGGGG + Intronic
1147443997 17:40463848-40463870 GAGCCCTAAGAACATCCCCGTGG - Intergenic
1152492767 17:80648806-80648828 GTGCCATAGGGGGAACCCAGTGG + Intronic
1152606298 17:81292616-81292638 GAGTCCTGAGGGCTGCCCAGAGG - Intronic
1156436683 18:37138366-37138388 GAGCACTAAGGGCAGCAGAGTGG - Intronic
1159829916 18:73263964-73263986 GAGCTATAAGGGCAGCCCAGTGG + Intronic
1159993705 18:74941042-74941064 GTGCCCTAAGTGAATCCCAGTGG + Intronic
1160531986 18:79571187-79571209 GCCCCCTCAGGGAAACCCAGAGG + Intergenic
1160677597 19:399644-399666 CAGCCCCAACGGCAGCCCAGGGG + Intergenic
1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG + Intronic
1165797065 19:38525671-38525693 GGGTCCTCAGGGCATCCCAGGGG - Intronic
1167220598 19:48196100-48196122 GAGACCAAAGGGGACCCCAGTGG + Intronic
1167248119 19:48386051-48386073 GTTCCCTAAGGGCAACCCCAGGG - Intronic
926692383 2:15746340-15746362 CAGCCCTCAAGGCAGCCCAGTGG - Intergenic
930369607 2:50486595-50486617 GAACTCTAAGGGGAAGCCAGTGG + Intronic
934104418 2:88682608-88682630 GTGCCCTTAGGGCAACCTGGAGG - Intergenic
935125592 2:100219861-100219883 GATCCTTAAGGACAACCCTGTGG + Intergenic
936090810 2:109500352-109500374 GAGCTCTGAGTGCACCCCAGGGG - Intronic
936991550 2:118372246-118372268 GAGGCCTAAGGGAAACATAGGGG - Intergenic
938383050 2:130847358-130847380 GAGCCCTCATGGGCACCCAGAGG + Intronic
945247614 2:207733782-207733804 CAGCTCTATGGGAAACCCAGTGG - Intronic
1171031957 20:21684872-21684894 GAGCACTCAGAGCATCCCAGTGG + Intergenic
1171352946 20:24518707-24518729 GGGCCCTAAGGCCATCACAGAGG + Intronic
1171771640 20:29326729-29326751 GAGCCGTCAGGGCTGCCCAGGGG + Intergenic
1174079785 20:47962684-47962706 GAACCCCAAGGGCTGCCCAGGGG - Intergenic
1174137915 20:48393234-48393256 GAGCCCCAAGGGCTGCCCAGGGG + Intergenic
1174542689 20:51302494-51302516 GAGCACGAAGAGCAACCCAGTGG + Intergenic
1175500366 20:59445838-59445860 GAACCCTAAGGCGAACTCAGTGG - Intergenic
1176256737 20:64156900-64156922 GAGCCGTATGGGCAGACCAGAGG + Intronic
1181780811 22:25191635-25191657 GAGCCCTGAGGACAACTCGGTGG - Intronic
1182547392 22:31084157-31084179 GAGGCCGTAGGGCAACCCAGTGG + Intronic
1185078715 22:48697145-48697167 AAGCCCTAACTGCACCCCAGTGG - Intronic
950095993 3:10330704-10330726 GAGCTCTCAGCGGAACCCAGGGG + Intronic
950790469 3:15467588-15467610 GACTCCTAAGAGCAACCCTGAGG - Intronic
952625989 3:35404325-35404347 GAGCCCTAATGGTAACATAGAGG + Intergenic
954965110 3:54603412-54603434 GACCCCTAAGGATACCCCAGAGG - Intronic
959612913 3:108314882-108314904 GAGCCTTGGGGTCAACCCAGTGG - Intronic
961818843 3:129564997-129565019 GAGCCTCAAGGGCCAGCCAGGGG + Intronic
967183059 3:186923077-186923099 GAGCCTTAGAGGTAACCCAGTGG + Intergenic
968973060 4:3806123-3806145 GAGCCTGGAGGGCATCCCAGGGG + Intergenic
970303960 4:14711470-14711492 CAGCTCTCAGGACAACCCAGTGG + Intergenic
980078770 4:128321823-128321845 AAGCCTTATGGGCCACCCAGGGG + Intergenic
981141770 4:141277653-141277675 TAGCTCTAGGGGAAACCCAGAGG - Intergenic
983641451 4:169947308-169947330 AAGCCACAAGGTCAACCCAGTGG + Intergenic
985578923 5:686509-686531 GAGCCCCGAGGGTAACCCAAGGG - Intronic
985593769 5:778572-778594 GAGCCCCAAGGGTAACCCAAGGG - Intergenic
988692335 5:33585260-33585282 GGGCAATAAGGGCAGCCCAGTGG - Intronic
988837516 5:35047787-35047809 GAGCCGTAAGTGGAAACCAGGGG - Exonic
989984225 5:50677829-50677851 TATCCCTAAATGCAACCCAGAGG - Intronic
990803145 5:59628562-59628584 GAGCCCTAACCTCAAGCCAGAGG + Intronic
993015916 5:82534491-82534513 GAGCCCTAACTGGATCCCAGTGG - Intergenic
994053128 5:95384465-95384487 GAGCCCTAAGGGAGACCCAAAGG + Intergenic
997431159 5:133842122-133842144 CAGGGCTAAGGGCCACCCAGTGG - Intergenic
1001721433 5:173860159-173860181 TTTCCCTAAGGGCAACACAGAGG + Intergenic
1001808147 5:174606693-174606715 GAGCCCTAAGGACAACGGAAAGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1003266441 6:4568572-4568594 GAGCCCAAAGGGCAGCCCAGAGG + Intergenic
1005926162 6:30447507-30447529 AAGCCCAGAGGGCACCCCAGAGG + Intergenic
1006015007 6:31073707-31073729 CAGGCCTAAGGGCAACCTGGAGG + Intergenic
1006415939 6:33903991-33904013 CAGCCCTGAGGGCATCCCAAAGG - Intergenic
1006629659 6:35422023-35422045 GAGCCCTTGGGGCAGCCTAGAGG + Intronic
1006771760 6:36559453-36559475 CAGCCCTCAGGGCAGCCAAGGGG + Intergenic
1007305384 6:40899925-40899947 GAGTCCTGAGGGCCGCCCAGAGG + Intergenic
1009494946 6:64334646-64334668 TAGCCATACAGGCAACCCAGAGG + Intronic
1018043055 6:159941810-159941832 GTGCTCTAAGGGCAGCCTAGTGG + Intergenic
1019143036 6:169960211-169960233 GAGCCCTCAGGGCCTCCCAGGGG + Intergenic
1020367518 7:7396160-7396182 GACCCCCTAGAGCAACCCAGTGG + Intronic
1020888051 7:13844412-13844434 GAGTCCTAAGGGTGACCAAGTGG - Intergenic
1026574290 7:71559436-71559458 CAGAACTAAGGGCAACCCAGGGG - Intronic
1030338453 7:108350292-108350314 GAGTCCCAAGGGGATCCCAGAGG - Intronic
1041371974 8:57171350-57171372 AAGACCTAGGAGCAACCCAGAGG - Intergenic
1047694685 8:127391698-127391720 GAGCCCCAAAGGCCCCCCAGAGG - Intergenic
1049421109 8:142517108-142517130 GAGCCCTGAGGGGAACCAGGGGG + Intronic
1049461183 8:142728555-142728577 GTGCCCTAAGGGCACACCAGGGG - Intronic
1049926134 9:409230-409252 GAGATCCAAGGGAAACCCAGTGG - Intronic
1057226401 9:93295613-93295635 AAGGCCTAAGGCCACCCCAGGGG - Intronic
1058586489 9:106512186-106512208 GAGCCTTAGGAGCAACCCATGGG + Intergenic
1061273041 9:129554632-129554654 GAGGCCTGAGGGCCACACAGGGG + Intergenic
1061875082 9:133539616-133539638 GAGCCCTAGAGGCCACCCCGTGG + Intronic
1061945702 9:133907297-133907319 GAGCCCTCAGGCCACACCAGAGG + Intronic
1062360694 9:136186578-136186600 CAGCCCTCTGGGCAACCCAAGGG + Intergenic
1062447036 9:136599427-136599449 GAGCCCTAGGTCCAGCCCAGGGG + Intergenic
1185562288 X:1069105-1069127 GAGTCCTAAGGGCAAGTAAGTGG + Intergenic
1197068646 X:122266696-122266718 AAGCCTTAAGGGAAACTCAGTGG - Intergenic