ID: 1081669740

View in Genome Browser
Species Human (GRCh38)
Location 11:44936402-44936424
Sequence TTCAAACAGAAGTGGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081669732_1081669740 24 Left 1081669732 11:44936355-44936377 CCAAATCCTAACGTGTGCATCTC 0: 1
1: 0
2: 1
3: 4
4: 57
Right 1081669740 11:44936402-44936424 TTCAAACAGAAGTGGCTCTGGGG 0: 1
1: 0
2: 1
3: 23
4: 230
1081669734_1081669740 18 Left 1081669734 11:44936361-44936383 CCTAACGTGTGCATCTCAGGTTA 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1081669740 11:44936402-44936424 TTCAAACAGAAGTGGCTCTGGGG 0: 1
1: 0
2: 1
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081669740 Original CRISPR TTCAAACAGAAGTGGCTCTG GGG Intronic
900468135 1:2835715-2835737 TCCAAACAAGAGTGGCTCAGTGG + Intergenic
900852550 1:5155412-5155434 TTCAAACAAAAGTAGCTTTAGGG + Intergenic
902847656 1:19124631-19124653 TTCTAACAGAAATGGTACTGAGG - Exonic
903279608 1:22243135-22243157 GTAAAACAGAAATAGCTCTGGGG + Intergenic
904733650 1:32613656-32613678 TTCACGCAGAGCTGGCTCTGCGG - Intronic
905208722 1:36358570-36358592 TTAAATCAGAAGTTGTTCTGAGG + Intronic
908310154 1:62873243-62873265 TCTAAACAGAAGTGGGTTTGGGG + Intergenic
909809577 1:79915677-79915699 TACAAACAGAACTGTCTATGGGG - Intergenic
910360329 1:86409507-86409529 TTCAGACAATAGTGGCTCTGAGG + Intergenic
911337187 1:96595268-96595290 TCCAAACAGAAGTGTTTCAGAGG + Intergenic
911344822 1:96683510-96683532 TTCTAATAGAACTGGCTTTGGGG - Intergenic
912662205 1:111542316-111542338 TTAAAAGAGAAGTGTCTGTGTGG + Intronic
914001816 1:143700803-143700825 TTTAAACAGAGCTGGCTGTGTGG + Intergenic
914399527 1:147304901-147304923 TTCAAAGAGAAGAGGCATTGTGG - Intergenic
914442442 1:147719254-147719276 TTCAAACAATAGTGGCTCCAAGG - Intergenic
916573260 1:166045639-166045661 TTCCAATAGAAGTGGGGCTGAGG + Intergenic
917357274 1:174139868-174139890 TGCAAAAAGAAGTGGAGCTGTGG - Intergenic
917855747 1:179098019-179098041 TTCACACAGAGCTGGCTGTGCGG - Intronic
918559242 1:185844835-185844857 TTTAAAGAGAAGAAGCTCTGGGG + Intronic
921244741 1:213225890-213225912 TTCAAATAGAATTGGCTTTCTGG + Intronic
921274562 1:213506098-213506120 TTCTCTCAGAAGGGGCTCTGAGG + Intergenic
921823170 1:219640832-219640854 TTCAAACAGATGAGTCCCTGCGG - Intergenic
922238644 1:223740227-223740249 TTCAAACAGAGGTGACTCAATGG - Intronic
922878127 1:228957232-228957254 TTCATGCAGAACTGGCTGTGTGG - Intergenic
922962603 1:229661605-229661627 TTCAAATAGAAATGACTGTGAGG - Intergenic
923274820 1:232386801-232386823 TTCTAGCAGAAGTGACTCTGTGG + Intergenic
923279791 1:232432413-232432435 TTCAAAAAGTAGTGGGTCTCTGG - Exonic
923709037 1:236370460-236370482 TTCACACAGAGCTGGCTGTGTGG + Intronic
1063864299 10:10347123-10347145 ATCACCCAGAAGAGGCTCTGTGG - Intergenic
1066260884 10:33728712-33728734 TTCATACAGAGCTGGCTGTGTGG - Intergenic
1067704886 10:48599259-48599281 TGCAAACAAAAGTGACCCTGGGG + Intronic
1069803774 10:71103859-71103881 TTCACACAGCATTGCCTCTGAGG + Intergenic
1071415081 10:85433696-85433718 TTCAGACAGCAGGGTCTCTGGGG - Intergenic
1072483557 10:95832260-95832282 TTCAAACTGAGAAGGCTCTGAGG - Intronic
1073641260 10:105254886-105254908 TCCACATAGAAGTGGATCTGCGG + Intronic
1075085529 10:119412149-119412171 TCCAATCAGAAGCGGATCTGAGG - Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075451335 10:122553736-122553758 TTCAGATGGAAGTGGCTCAGGGG + Intergenic
1076490145 10:130854842-130854864 TAAAGACAGAAGTTGCTCTGAGG - Intergenic
1078758633 11:14234188-14234210 TTCAAACAGAAAGGGCTGTGAGG - Intronic
1078920600 11:15826721-15826743 TCCAGTCAGAAGTGGCTCTAAGG + Intergenic
1081669740 11:44936402-44936424 TTCAAACAGAAGTGGCTCTGGGG + Intronic
1081863854 11:46348865-46348887 TTCAGTCTGAGGTGGCTCTGGGG - Intronic
1082835583 11:57648281-57648303 GACAAACAGCAGTGACTCTGTGG + Exonic
1083952390 11:65964165-65964187 TTCTAAGAGAGGTGGCTCTGGGG + Intronic
1086279073 11:85164620-85164642 TTTCAACAGAATTGACTCTGGGG - Intronic
1087084157 11:94199509-94199531 ATCAACCAACAGTGGCTCTGGGG + Intergenic
1088498327 11:110455468-110455490 ATCAAACTGAAGTTACTCTGAGG + Intronic
1090637835 11:128703258-128703280 CTCAAATAGATGTTGCTCTGTGG - Intronic
1092100688 12:5881413-5881435 TTCACAGAGACTTGGCTCTGTGG - Intronic
1093101027 12:15029620-15029642 TTCACACAGAGCTGGCTGTGTGG + Intergenic
1094276367 12:28680643-28680665 TTCAAACAAGAGATGCTCTGAGG + Intergenic
1095267773 12:40180369-40180391 TTCACACAGAGCTGGCTGTGTGG - Intergenic
1095968086 12:47882892-47882914 TGCAAACAGAAGTGGCTTGTTGG + Intronic
1096325890 12:50661516-50661538 TTGAAAGAGAAATAGCTCTGTGG + Intronic
1096804940 12:54134848-54134870 CAGACACAGAAGTGGCTCTGAGG - Intergenic
1097471063 12:59991989-59992011 TTCCAAGAGCAGTTGCTCTGTGG - Intergenic
1097603046 12:61718996-61719018 TACAAACACAAATGGCTCTTAGG + Intronic
1098507782 12:71274521-71274543 TCCAAACACAAGCAGCTCTGTGG - Intronic
1098598505 12:72301336-72301358 TTCCATCAGAAGGGCCTCTGTGG + Intronic
1098711659 12:73770187-73770209 TTCACACAGAGCTGGCTGTGTGG - Intergenic
1098900590 12:76108455-76108477 TAAAAATAGAAATGGCTCTGAGG + Intergenic
1102660535 12:114523651-114523673 GGGAAACAGAAGTGGTTCTGGGG + Intergenic
1103539744 12:121657912-121657934 TTAACACAGAACTGGCTGTGTGG - Intronic
1104265739 12:127231184-127231206 TTCACACAGACCTGGCTATGTGG - Intergenic
1106155098 13:27147206-27147228 TTAAAAAGGCAGTGGCTCTGAGG - Intronic
1109081010 13:57901389-57901411 TTGTAACAAAAGTTGCTCTGCGG - Intergenic
1109141743 13:58720934-58720956 TTCAAAATAAAATGGCTCTGTGG - Intergenic
1109469992 13:62791617-62791639 TTCACATAGAACTGGCTGTGTGG + Intergenic
1109478496 13:62916634-62916656 TTCAAACATAAATGGCTATAAGG + Intergenic
1110467446 13:75818321-75818343 TTAAAGCAGGAGTGGCTCTGTGG + Intronic
1110736227 13:78940226-78940248 CACAAACAGTAGTGCCTCTGTGG - Intergenic
1115389232 14:32835825-32835847 TTAAAAAAGAAGTGGCTATACGG - Exonic
1116797165 14:49403984-49404006 GTCAAACAGAAGTCCCTCTGGGG - Intergenic
1119788668 14:77330484-77330506 TCCAGGCAGAAGTGGCTATGTGG - Intronic
1120053427 14:79895181-79895203 TGCAAACAGAAGTTACTCAGGGG - Intergenic
1120275418 14:82367270-82367292 TTAAAGCAGAAGTGGCACTCTGG + Intergenic
1120348916 14:83327554-83327576 TTCAGACAAAAGAGGCTCTTGGG + Intergenic
1121245634 14:92459292-92459314 TCCATAGAGAAGTGGCTGTGCGG + Intronic
1121789127 14:96685817-96685839 TTCACAAGGAAGTGGCTCTGTGG - Intergenic
1202829639 14_GL000009v2_random:13504-13526 TACAAACGGAAGTGAGTCTGTGG + Intergenic
1125297331 15:38217526-38217548 TGTAAACTCAAGTGGCTCTGGGG - Intergenic
1128527453 15:68422152-68422174 TTCACACAGACGTGCCTCAGTGG - Intronic
1130691072 15:86081848-86081870 TTCAACCTGAAGTGACTTTGAGG - Intergenic
1131208215 15:90470045-90470067 TTCAAACATGAGTGTTTCTGTGG - Intronic
1131969165 15:97875154-97875176 TTCCAACAAAAGTGGCTTTGTGG + Intergenic
1132395705 15:101472488-101472510 TTCAAACAAAACTGACGCTGTGG + Intronic
1132797643 16:1733198-1733220 CTCAGACAGGAGTGCCTCTGAGG + Intronic
1132834225 16:1944629-1944651 TTCACACAGAGCTGGCTGTGCGG - Exonic
1135252748 16:20914838-20914860 TACAAACTCAAGTGCCTCTGCGG - Intronic
1137453268 16:48597168-48597190 TTCACACAGAGCTGGCTGTGTGG - Intronic
1139242188 16:65404390-65404412 TTGAAAGTTAAGTGGCTCTGTGG - Intergenic
1140507803 16:75485032-75485054 TTAAAGCAGAATTGCCTCTGAGG - Intronic
1140662382 16:77199781-77199803 TTCAAACAAAAGTGGGGCGGTGG + Exonic
1140847104 16:78901421-78901443 ATGAAACAGAAGTGGTTGTGGGG - Intronic
1140899576 16:79355420-79355442 GTTAAAGAGAAGTGGCTCTGAGG + Intergenic
1141136624 16:81469828-81469850 TTCAAACAGAACTGGCCTGGTGG - Intronic
1143600220 17:7940273-7940295 TTCTGACAGAAGTAGATCTGAGG + Intronic
1145415430 17:22710351-22710373 GTTAACCAGAGGTGGCTCTGGGG + Intergenic
1150328403 17:64275004-64275026 ATCAAACAGAACTAGCTCTTAGG + Intergenic
1154412767 18:14150236-14150258 CTCAAACAGAAGTGTCTTGGAGG - Intergenic
1155133531 18:22963541-22963563 TTCAAACAGATCTGTCTCAGAGG + Intronic
1155282432 18:24253517-24253539 TTCACACAGAGCTGGCTGTGTGG + Intronic
1156281444 18:35643136-35643158 TACAAACAGAAGTGGCTGCCGGG - Intronic
1158914012 18:62101935-62101957 AACAAACTGAAGTGGCTGTGTGG + Intronic
1168613170 19:57817042-57817064 TTCTGACAGAAGTAGTTCTGAGG - Intronic
927407403 2:22786715-22786737 TTCAATCAGATGAGGCTGTGAGG - Intergenic
928141319 2:28731821-28731843 TTAAAAGAGAGCTGGCTCTGAGG + Intergenic
928822347 2:35376630-35376652 TTCCCACTGAAGTCGCTCTGAGG - Intergenic
929336227 2:40749556-40749578 TCAAAACAGATGTGACTCTGTGG + Intergenic
930504499 2:52265093-52265115 TTGAAACAGAAGTTGCCCCGGGG + Intergenic
930966835 2:57338897-57338919 CTCAAAAAGAAGTTACTCTGTGG + Intergenic
931588659 2:63856784-63856806 TTCTATCAGAAGTGACTCTCTGG - Intronic
933247629 2:79993765-79993787 AATAAAAAGAAGTGGCTCTGGGG + Intronic
933980748 2:87548954-87548976 TTAGAAAAGAAATGGCTCTGAGG - Intergenic
935146469 2:100398901-100398923 TACACACAGAAGTTGCTCAGAGG + Intronic
936313079 2:111401831-111401853 TTAGAAAAGAAATGGCTCTGAGG + Intergenic
936622465 2:114114571-114114593 TTCACACATAAGTGGTTCTATGG + Intergenic
937795877 2:126019437-126019459 TTCACACAGAGCTGGCTGTGTGG - Intergenic
938728147 2:134124870-134124892 TTCAAACAGGAGTGGGTGGGTGG - Intronic
940110469 2:150147112-150147134 TTCACACAGAGATGGCTGTGTGG + Intergenic
940801319 2:158136338-158136360 TTCAAACTGAAGCCTCTCTGAGG - Intergenic
940910332 2:159204575-159204597 TTCAAACAGAAGGACCTCTGAGG - Intronic
944194231 2:197035722-197035744 TTGACACAGAAGTGGCCCTGAGG - Intronic
944882302 2:204026097-204026119 TTCAGACAGAGATGGCCCTGAGG - Intergenic
948041934 2:234909124-234909146 TTCACACAGTAGTGGCACTATGG - Intergenic
948861558 2:240755093-240755115 TTCCAACAGGAGTGGGCCTGGGG - Intronic
1170196392 20:13693517-13693539 CTCAAAGAGAAGTGGCAGTGGGG - Intergenic
1173081456 20:39872049-39872071 TTCAAAGAGCACAGGCTCTGGGG + Intergenic
1175210715 20:57352315-57352337 TTCAAACGGAGGTAGCTGTGGGG + Intronic
1175599368 20:60260358-60260380 TTCGCACAGAACTGTCTCTGAGG - Intergenic
1176860239 21:14008019-14008041 CTCAAACAGAAGTGTCTTGGAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178822853 21:35991312-35991334 TGCAAACAGAGGTGGCCTTGCGG + Intronic
1183121881 22:35736414-35736436 TGCAGACAGAAGTGCCTCAGGGG + Intergenic
1184913731 22:47552742-47552764 TCCAAACAGATTCGGCTCTGCGG + Intergenic
949997557 3:9630458-9630480 TTCACACAGAATTGGCTGTGTGG + Intergenic
950192119 3:10984326-10984348 TTCAACAAGAAGGAGCTCTGAGG - Intergenic
952252612 3:31669568-31669590 TACTCACAGTAGTGGCTCTGAGG + Intronic
952379253 3:32791763-32791785 TTCAAGCAGAAGGGATTCTGAGG - Intergenic
952934591 3:38386290-38386312 GGCAAACAGAAGTGGCTCAAGGG - Intronic
952994071 3:38860247-38860269 TTCACACAGAGCTGGCTGTGTGG - Intronic
953612673 3:44460743-44460765 TTCACACAGAACTGGCTGTGCGG - Intronic
954060731 3:48064524-48064546 TTCAAGCAGAACTGACTGTGTGG - Intronic
956307902 3:67846974-67846996 TTCAACCAGCAGAGGGTCTGAGG + Intergenic
956351410 3:68341132-68341154 TTCACACAGAGGTGGCTGTGTGG + Intronic
957193717 3:77040896-77040918 TTCAAAAAGAAATGGTTTTGGGG - Intronic
957667403 3:83250757-83250779 TTGAATCACAAGTGGCTATGTGG - Intergenic
959397633 3:105860903-105860925 TTCAAACCCAAGAGGCTCTCAGG + Intronic
961008232 3:123419281-123419303 TTCAAAGAGAAGTGGGTGGGCGG - Intronic
961404274 3:126667550-126667572 TCCTAACAGAAGTGGCCATGTGG + Intergenic
962879363 3:139561655-139561677 TTCTAACAGAAGTCTGTCTGTGG + Intronic
963171625 3:142257003-142257025 TTCACACAGAGCTGGCTGTGCGG + Intergenic
964477975 3:157113750-157113772 CTGAAGCAGAGGTGGCTCTGAGG + Intergenic
965304166 3:167043199-167043221 TTTCAACAGACGTGGCTCTCTGG + Intergenic
965805621 3:172538494-172538516 TTCACGCAGAACTGGCTGTGCGG - Intergenic
967515398 3:190362540-190362562 TTCAAACAGAGCCAGCTCTGCGG - Intronic
967653994 3:192023865-192023887 TTCAATCTGAAGAGGCTGTGGGG - Intergenic
968310001 3:197675344-197675366 TGCTAACAGGGGTGGCTCTGGGG + Intronic
968451062 4:676279-676301 ATCAAAAATAAGTGTCTCTGGGG + Intronic
970687056 4:18580503-18580525 TTTAAACCAGAGTGGCTCTGAGG + Intergenic
970796017 4:19914391-19914413 TTCAAACTGAAGGGAATCTGGGG + Intergenic
977634782 4:99284722-99284744 TTCAAGCAGTAGTTGCTCTCCGG + Exonic
977637496 4:99316221-99316243 TTCAAGCAGTAGTTGCTCTCCGG + Exonic
977681404 4:99802085-99802107 TGCACACAGAAGTGGCAGTGAGG - Intergenic
979898898 4:126192888-126192910 TTCACACAGAGCTGGCTGTGTGG - Intergenic
980539712 4:134177615-134177637 TTCACATAGAAGTGGAACTGCGG - Intergenic
981696919 4:147568274-147568296 TTCACACAGAGCTGGCTGTGAGG - Intergenic
984041391 4:174738974-174738996 TTTGAACAGAAGTTGCTCAGTGG - Intronic
984097834 4:175453507-175453529 TTCACGCAGAACTGGCTGTGTGG + Intergenic
986823018 5:11489378-11489400 GTCAAAAAGAAGTAGGTCTGTGG - Intronic
988419865 5:30992261-30992283 TTCACACAGAGCTGGCTGTGTGG - Intergenic
989196625 5:38722986-38723008 TTCAAGCAGGAGGGGCTGTGGGG + Intergenic
991098438 5:62764406-62764428 GTTAAACAGAAGTAGATCTGTGG - Intergenic
992009476 5:72512402-72512424 TTCACACAGAGCTGGCTGTGAGG + Intergenic
992261846 5:74978506-74978528 TGCAAGCAGAAGTAGCCCTGTGG + Intergenic
992380848 5:76236150-76236172 ATCAAACAAAACTGGCTCTGTGG + Intronic
992839980 5:80679073-80679095 ACCTAACAGATGTGGCTCTGTGG - Exonic
992846435 5:80753769-80753791 TTAAAACTGAAGAGCCTCTGGGG - Intronic
993213649 5:84990001-84990023 TTTAAACAGTAGTGGTTCTTTGG - Intergenic
993421927 5:87713780-87713802 TTCACACAGAGCTGGCTGTGTGG + Intergenic
993648026 5:90483223-90483245 TTCACACAGAGCTGGCTGTGCGG - Intronic
994006734 5:94846108-94846130 TTAAAACAGAATTGGCTATTCGG + Intronic
995958474 5:117810155-117810177 TTAAAACAAAATTGGCTCTTGGG + Intergenic
996077897 5:119218954-119218976 CTCAAACAGAACTGTTTCTGTGG - Intronic
996317272 5:122174207-122174229 TTCAGATAGAAGTGGATATGTGG - Intronic
998349159 5:141489760-141489782 TTCAGAGAGAAGTGGCTGTTGGG - Exonic
1000003514 5:157162623-157162645 TTGAACCAGGAGTGGCCCTGAGG + Exonic
1000725379 5:164763182-164763204 TTCACACAGAGCTGGCTGTGCGG + Intergenic
1001516107 5:172356296-172356318 TTCAAGCAGAGCTGGATCTGGGG - Intronic
1001579746 5:172790437-172790459 TTGAAGCTGAAGAGGCTCTGAGG - Intergenic
1003047858 6:2751266-2751288 GGCAAACAGAGGTGGCTGTGGGG - Intergenic
1004733661 6:18383779-18383801 TAGAATCAGAAGTGCCTCTGGGG - Intergenic
1007598106 6:43064266-43064288 TTCACAGAGAAATGTCTCTGAGG + Intronic
1007951291 6:45874836-45874858 TTTAAATAGAATTAGCTCTGGGG + Intergenic
1009995560 6:70891577-70891599 TACAAACAGGACAGGCTCTGAGG + Intronic
1010153142 6:72759900-72759922 TTCAAATGGAAGTGCCTGTGAGG + Intronic
1010248723 6:73686241-73686263 TTCAAATTGATGTGTCTCTGAGG + Intergenic
1011189525 6:84715174-84715196 CTGAAACAGAAGTGGCTTTCAGG - Intronic
1012259698 6:97073276-97073298 ATCAAAGAGAAGTGGCTAAGAGG - Intronic
1015311575 6:131772797-131772819 TTCACACAGAGCTGGCTCTGCGG + Intergenic
1017560763 6:155625835-155625857 GTCAAACAGACTTGGATCTGAGG - Intergenic
1018112348 6:160547719-160547741 TTCAAACAGAAGAGGGGCAGAGG - Intronic
1023198022 7:37663515-37663537 TTCACACAGAGCTGGCTGTGTGG - Intergenic
1027264913 7:76489119-76489141 CTCAAACAGGATTGCCTCTGTGG - Intronic
1027316286 7:76987222-76987244 CTCAAACAGGATTGCCTCTGTGG - Intergenic
1027810940 7:82896975-82896997 TTCAAACAGCTGTGTTTCTGAGG + Intronic
1030175066 7:106644022-106644044 TGCAAACAGAGGTGGTTGTGAGG - Intergenic
1030656434 7:112173499-112173521 GCCAAACAGAAGTGGCTTTGAGG + Intronic
1030867809 7:114721086-114721108 ATCAACCAGAAGTTGCACTGGGG - Intergenic
1032534521 7:132651023-132651045 TTGATACAGAAGTGGCTTTTGGG + Intronic
1032679700 7:134168913-134168935 TTCCAAGAGAAGTGGCTCCATGG - Intronic
1033077008 7:138258948-138258970 TTCACACAGAGCTGGCTGTGTGG - Intergenic
1033561929 7:142540467-142540489 TTCAAAGAGAAGTGTCTTAGAGG - Intergenic
1033823764 7:145164521-145164543 TCCAGACAGAGGAGGCTCTGAGG - Intergenic
1034399102 7:150849633-150849655 TGCAGACACAAGTGGCTGTGAGG - Intronic
1036047962 8:5165198-5165220 TTCACACGGAACTGGCTGTGTGG + Intergenic
1037134336 8:15444047-15444069 TTCATACAGAACTGGTTCTGTGG - Intronic
1039960528 8:42243634-42243656 TTCAAACCGAAGTGGCTTTATGG - Intergenic
1040994527 8:53388532-53388554 TTCATGCAGAACTGGCTGTGTGG - Intergenic
1041654780 8:60337722-60337744 TTTAAACACAAGAGGCTGTGAGG - Intergenic
1045302624 8:100926947-100926969 TATAAACATAAGTGGCTTTGGGG + Intronic
1047341570 8:123985484-123985506 TTCAAAGAGCACTGGGTCTGTGG + Intronic
1047356866 8:124130071-124130093 TTCAGACAGAAGTGGGACTGTGG - Intergenic
1047385119 8:124401841-124401863 TTCACACAGAGCTGGCTATGCGG - Intergenic
1048086504 8:131186483-131186505 TTCACACAGAATTCGCACTGGGG + Intergenic
1048496029 8:134936924-134936946 TTGAATCAGAGGAGGCTCTGAGG + Intergenic
1050271560 9:3951340-3951362 AAGAAAAAGAAGTGGCTCTGTGG - Intronic
1054677983 9:67878833-67878855 TACAAACAGGAGTGAGTCTGTGG + Intronic
1055120751 9:72658044-72658066 TTCAAACACAAGAGGATATGAGG - Intronic
1055723813 9:79205806-79205828 GTCAAACAGACCTGGCTTTGAGG + Intergenic
1055971222 9:81914975-81914997 CTCATACAGAAGTCACTCTGTGG - Intergenic
1055972955 9:81930028-81930050 ATCATACAGAAGTAACTCTGTGG - Intergenic
1055974708 9:81945100-81945122 ATCATACAGAAGTAACTCTGTGG - Intergenic
1056639000 9:88354309-88354331 TTCACACAGAGCTGGCTGTGTGG - Intergenic
1059836944 9:118165587-118165609 TTCAATCAGAATTTTCTCTGGGG - Intergenic
1060356808 9:122915784-122915806 TCCAAACTGAAGTGGCTCTGAGG - Exonic
1186856042 X:13627097-13627119 AGCAAACAGAAGTTGCTTTGGGG - Exonic
1188514223 X:30967987-30968009 TTAAAACAGTAATGGATCTGTGG - Intronic
1190039980 X:47063342-47063364 TTCAAACAAAGGTGGCTCTAGGG + Intergenic
1190774698 X:53543426-53543448 CACAGACAGAAGTGGCTGTGTGG + Intronic
1191243731 X:58209543-58209565 TTCAAACAGAAGAGACTCCTGGG + Intergenic
1191812354 X:65202990-65203012 TTCAATCAGAAGAGTCTCTGTGG + Intergenic
1192127187 X:68512757-68512779 TTAAAACAGAATTAGCTCAGTGG + Intronic
1193436482 X:81479723-81479745 TTTTGACAGAAGTGGCTGTGGGG - Intergenic
1194411536 X:93564350-93564372 TTCACACAGAGCTGGCTGTGCGG - Intergenic
1194447692 X:94007964-94007986 TTCACACAGAGATGGCTGTGTGG + Intergenic
1195174879 X:102305796-102305818 TCCAAATAGCAGAGGCTCTGAGG + Intergenic
1195183986 X:102381297-102381319 TCCAAATAGCAGAGGCTCTGAGG - Intronic
1196458748 X:115908341-115908363 TTGAAACAGAAGTAGCTTTGAGG - Intergenic
1196619600 X:117807050-117807072 TTCCAACAGTGGTGGCTATGGGG + Intergenic
1198020655 X:132654397-132654419 TTCAAATAGAAGTGCCTGTAGGG + Intronic
1198138278 X:133776764-133776786 TTGGAACAGAAGTGTCTCTTAGG - Intronic
1199412230 X:147537456-147537478 TTCATACAGAGGTGGTTATGTGG - Intergenic
1201634123 Y:16103564-16103586 TTCACACAGACCTGGCTGTGTGG + Intergenic