ID: 1081670382

View in Genome Browser
Species Human (GRCh38)
Location 11:44939062-44939084
Sequence TGCTGGCGGTGGGGGAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1425
Summary {0: 1, 1: 0, 2: 11, 3: 138, 4: 1275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081670382_1081670398 28 Left 1081670382 11:44939062-44939084 CCCCCACTCCCCCACCGCCAGCA 0: 1
1: 0
2: 11
3: 138
4: 1275
Right 1081670398 11:44939113-44939135 CTGCGTGCCAGCCCCTGTGCTGG 0: 1
1: 0
2: 25
3: 174
4: 783
1081670382_1081670395 -3 Left 1081670382 11:44939062-44939084 CCCCCACTCCCCCACCGCCAGCA 0: 1
1: 0
2: 11
3: 138
4: 1275
Right 1081670395 11:44939082-44939104 GCAACATCTTGGACCAGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1081670382_1081670392 -8 Left 1081670382 11:44939062-44939084 CCCCCACTCCCCCACCGCCAGCA 0: 1
1: 0
2: 11
3: 138
4: 1275
Right 1081670392 11:44939077-44939099 CGCCAGCAACATCTTGGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1081670382_1081670394 -4 Left 1081670382 11:44939062-44939084 CCCCCACTCCCCCACCGCCAGCA 0: 1
1: 0
2: 11
3: 138
4: 1275
Right 1081670394 11:44939081-44939103 AGCAACATCTTGGACCAGGTTGG 0: 1
1: 0
2: 2
3: 10
4: 129
1081670382_1081670399 29 Left 1081670382 11:44939062-44939084 CCCCCACTCCCCCACCGCCAGCA 0: 1
1: 0
2: 11
3: 138
4: 1275
Right 1081670399 11:44939114-44939136 TGCGTGCCAGCCCCTGTGCTGGG 0: 1
1: 1
2: 38
3: 313
4: 1432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081670382 Original CRISPR TGCTGGCGGTGGGGGAGTGG GGG (reversed) Intronic
900117613 1:1035160-1035182 GGCTAGCGGTGGGGGGGGGGGGG + Intronic
900166190 1:1245150-1245172 TGGGGGAGGAGGGGGAGTGGGGG - Intronic
900391178 1:2434660-2434682 TGCTGGCTGTGGGGGGAAGGGGG - Intronic
900432809 1:2611066-2611088 TGCTGGAGGCTGGGGACTGGGGG + Intronic
900472910 1:2863401-2863423 TGCTGGCCACGGGGGGGTGGTGG + Intergenic
900495871 1:2975778-2975800 TGCAGGCGGAGGGCGAGGGGTGG - Intergenic
900497152 1:2980921-2980943 AGCTGGGGGTGGGGGCGGGGGGG + Intergenic
900511193 1:3061935-3061957 GGCTGACGGTGTGGGAGGGGTGG + Intergenic
900716019 1:4144582-4144604 TGGTGGTGGTGTGGTAGTGGTGG - Intergenic
901020442 1:6252552-6252574 TGCTGGGGGTGGGGCAGTGGGGG + Intronic
901321752 1:8344314-8344336 TCCTGGGGGTGGGGGTGGGGTGG - Intergenic
901633192 1:10657784-10657806 GGCAGGCGGTGGGGGGGTGGGGG + Intronic
901671274 1:10857743-10857765 TGCTGGGGGTGGGGGCGGGGGGG - Intergenic
901687001 1:10948569-10948591 GGCTGGCGGTGAAGGAGAGGAGG + Exonic
901790935 1:11653524-11653546 GGCTGGAGGCGGGGGAATGGGGG + Intronic
902029491 1:13411329-13411351 TTTTGGCGGTGGGGGGGAGGGGG - Intronic
902272288 1:15313318-15313340 TGCTGGGGGCGGGGTGGTGGGGG + Intronic
902330026 1:15726797-15726819 TGCTGGCAGGGGCGGGGTGGGGG - Intronic
902565019 1:17305690-17305712 TGGTGGCAGTGGAGGAGGGGAGG - Intergenic
902729792 1:18361998-18362020 TGCCGGGGGTGGGGGAGGGCAGG - Intronic
902798599 1:18815483-18815505 TGCTGGCCATGGGGGAAGGGAGG + Intergenic
902798651 1:18815870-18815892 GGCTGGGGGTGGGGGACTGGCGG - Intergenic
902941020 1:19800097-19800119 TGGTGGAGGTGGGGCAGAGGTGG - Intergenic
902960792 1:19961730-19961752 GGGTGGGGGTGAGGGAGTGGGGG - Intergenic
903196906 1:21696890-21696912 TGGGGGCGGTGGGGGATGGGGGG + Intronic
903446337 1:23424781-23424803 GGCGGGCGGTGGGGGGGTGGGGG - Intergenic
903652022 1:24928414-24928436 TCCTGGGGGTGGGGGATTTGGGG - Intronic
904175858 1:28628219-28628241 TGCAGGGGGTGGGGGGGGGGGGG + Intronic
904306159 1:29591782-29591804 TGCTGGGGGTGGGGGTGTGATGG + Intergenic
904351343 1:29908871-29908893 TGCTGGCGTTGGGGTAGGTGGGG - Intergenic
904377980 1:30093790-30093812 TGCTGGTGGTGGTGGAGGGTGGG + Intergenic
904530342 1:31164537-31164559 GGCTGGGGGTGGAGGGGTGGGGG - Intergenic
904617752 1:31759024-31759046 TGCTGTAAGTGGGGGAGGGGAGG - Intronic
904618953 1:31764152-31764174 TGCTCGGGGCGGGGGAGCGGGGG - Intronic
904671595 1:32170126-32170148 TGTTGGTGGTGGCGGAGTGTGGG + Intronic
904799538 1:33082596-33082618 TGTGGGCGGTGAGGGAGAGGGGG - Intronic
904806674 1:33137033-33137055 TGTTGGGAGTGGGGGAGTGACGG + Intergenic
904842078 1:33379330-33379352 AGGGGGCGGTGGGGGGGTGGGGG - Intronic
904924552 1:34037297-34037319 TGCCGCCGGTGGGGGCGGGGAGG - Intronic
905075817 1:35269276-35269298 TGCTGGGTGGGGGGGAGGGGAGG + Intronic
905258802 1:36703223-36703245 TGCTGGAGGTGGGGGCCTAGTGG - Intergenic
905289713 1:36913003-36913025 TGCTGGAGCTGGGGTAGCGGAGG - Intronic
905455611 1:38086010-38086032 TGCTGGCTGGGGCGGGGTGGCGG + Intergenic
905797184 1:40822411-40822433 TGCTGGGGGTGGGGGTGGGTGGG + Intronic
906197258 1:43936729-43936751 CGCAGGCGGTGGCGGAGAGGCGG - Exonic
906201564 1:43963834-43963856 GGATGGCGGTGGGGGGGTGGGGG - Intronic
906354477 1:45092536-45092558 GGCTGGCGGGGGGGGGGGGGTGG - Intronic
906392186 1:45427771-45427793 TGTGGGGTGTGGGGGAGTGGGGG + Intronic
906412025 1:45586147-45586169 TGCTGGGTGTGTGGGGGTGGGGG + Intronic
906460914 1:46034715-46034737 TGTTGGGGGTGGGGGAGAAGGGG - Exonic
906461254 1:46036314-46036336 TGCTGGGTGTGGAAGAGTGGAGG + Intergenic
906642915 1:47452264-47452286 TGGTGGGGAAGGGGGAGTGGGGG + Intergenic
906807283 1:48791430-48791452 TGATGGGGATGGGGGAATGGAGG - Intronic
906836944 1:49094217-49094239 TGGTGGGGGTAGGGGAGTGGGGG - Intronic
907357264 1:53886557-53886579 TGCTGGGGGTGGGGTGGCGGGGG - Intronic
907431090 1:54411958-54411980 AGGTGGAGTTGGGGGAGTGGTGG - Intronic
907438380 1:54463716-54463738 TTCTGGGGGTGGGAGAATGGGGG + Intergenic
907558302 1:55364851-55364873 TGGTGGCAGTGGTGGGGTGGGGG - Intergenic
907586035 1:55618797-55618819 TGCTGGGGGAGGGGGACTGCAGG + Intergenic
907604921 1:55806783-55806805 TGCTGGGGCTAGGGGAGAGGTGG - Intergenic
908327704 1:63039789-63039811 TTCTGGCGGTGGGGTTGGGGAGG + Intergenic
909666133 1:78135166-78135188 AGTTGGCAGTGGGGGACTGGTGG + Intronic
909717362 1:78725397-78725419 TTTTGGGGGTGGGGGGGTGGGGG + Intergenic
909736458 1:78968494-78968516 GGAGGGCGGTGGGGGGGTGGGGG + Intronic
909797463 1:79759616-79759638 GCCAGGTGGTGGGGGAGTGGGGG - Intergenic
909902956 1:81160858-81160880 TGCTGGGGGATGGGGAGGGGTGG - Intergenic
910102025 1:83587748-83587770 TAGTGGCAGTGGGGGTGTGGGGG - Intergenic
910229734 1:84973927-84973949 TGCTGGGGCTGGGGGAAGGGTGG - Intronic
910408402 1:86914593-86914615 TGGTGGCGGAGGGGGATGGGCGG + Intergenic
910498992 1:87867163-87867185 TGCTGGCGGGGGGGCGGGGGGGG - Intergenic
911001751 1:93173040-93173062 AGCTGGGGGTGGGGGACTTGGGG + Intronic
911232389 1:95374626-95374648 TGCTGCCGGTGGCAGCGTGGGGG + Intergenic
911651961 1:100398943-100398965 TTCTGGTGGTAGGGGAGTGAAGG + Intronic
912135755 1:106658774-106658796 TGCTGGGGGTGGGAAAGGGGTGG - Intergenic
912260763 1:108109927-108109949 TGCTGGTGGTGGGGGAGGAGGGG - Intergenic
912367983 1:109150486-109150508 TGCTTGCTCTGGGGGAGAGGAGG + Intronic
912637396 1:111310284-111310306 TGCTGGTGGTGGGAGGGTGTAGG + Intronic
913200068 1:116488700-116488722 TGGTGGGGGTGGGGGTGTGGAGG + Intergenic
913462445 1:119102054-119102076 TGGTGGCGGTGGGGGTTGGGGGG + Intronic
913690952 1:121279361-121279383 TACAGGGGGTGAGGGAGTGGGGG - Intronic
914005561 1:143729653-143729675 GGCTGGGGGTGGGGGGGGGGGGG - Intergenic
914146588 1:145000602-145000624 TACAGGGGGTGAGGGAGTGGGGG + Intronic
914346036 1:146799281-146799303 TGCTGTTGGTGGGGGCATGGTGG + Intergenic
914771797 1:150693471-150693493 TGCAGGCGGTGGGCGAGGGGGGG + Intronic
914901308 1:151712565-151712587 TCATGGAGGTGGTGGAGTGGGGG - Intronic
915038275 1:152946871-152946893 TGCTGGGTGTGGGGGTGTGAGGG - Intergenic
915121450 1:153631950-153631972 TGGTGGGGGTGGGGGTGGGGTGG - Exonic
915163160 1:153933587-153933609 TGCGGGAGGCAGGGGAGTGGCGG + Exonic
915344997 1:155192946-155192968 GGCGGGCGGGCGGGGAGTGGGGG - Intergenic
915349783 1:155217113-155217135 TCCTGGGGGTGGGAGGGTGGGGG - Intergenic
915353042 1:155238390-155238412 TCCTGGGGGTGGGAGGGTGGAGG - Intronic
915570858 1:156744444-156744466 GGGTGGGGGTGGGGGAGAGGCGG - Intronic
915741300 1:158120321-158120343 TACTGGGGATGAGGGAGTGGGGG + Intergenic
915951030 1:160190196-160190218 AGCTGGGGCTGGGGGAGGGGAGG - Intergenic
916084695 1:161259669-161259691 TTCATGGGGTGGGGGAGTGGGGG + Intronic
916085918 1:161269243-161269265 TGCTGAGGGTGGGGAAGGGGGGG + Intronic
916785374 1:168083327-168083349 TGGGGTCAGTGGGGGAGTGGGGG + Exonic
917487372 1:175467274-175467296 TGCTGGTGGGGTGGGAGAGGTGG - Intronic
917837771 1:178954368-178954390 TGCTGTCGGTGGCGGCGGGGTGG - Intergenic
917876540 1:179291897-179291919 TGCTTGTGGTGGGGGATGGGGGG - Intergenic
918133123 1:181646369-181646391 TGCTGGCAGTGCTGCAGTGGAGG + Intronic
918138802 1:181702564-181702586 AGCAGGCAGTGGGGAAGTGGAGG - Intronic
919576077 1:199311321-199311343 TGGTGGTGGTGGGGGCGGGGTGG - Intergenic
919760967 1:201097768-201097790 TGCTGGTGGTGGGTGAGGGGAGG + Intronic
919909298 1:202100928-202100950 TGCTTGAGGTGGGGAGGTGGAGG - Intergenic
919937813 1:202266191-202266213 GCCTGGAGGTGGGGGAGTGGGGG + Intronic
920331256 1:205210472-205210494 TGCTGTTGGTGGGGAACTGGAGG - Intronic
920421597 1:205837992-205838014 TGAGGGGGTTGGGGGAGTGGGGG - Intronic
920478274 1:206297836-206297858 TACAGGGGGTGAGGGAGTGGGGG - Intronic
920899645 1:210094782-210094804 GGCTTGGGGTTGGGGAGTGGGGG - Intronic
920951926 1:210580486-210580508 TGCTGGGGGGTGGGGGGTGGGGG - Intronic
920967454 1:210712907-210712929 TGCTGGGGTTGGGGGACTAGGGG - Intronic
921002124 1:211055193-211055215 TGCTGGGGATAGGGGAGGGGTGG - Intronic
921267196 1:213431008-213431030 GGTTGGGGGTGGGGGAGTGTGGG + Intergenic
921618058 1:217295482-217295504 TGGTGGTGGTGGTGGGGTGGGGG - Intergenic
921847234 1:219897223-219897245 TGGTGGGGGTGGGGGTGGGGTGG - Intronic
922167154 1:223125636-223125658 TGGTGTTGGTGGGGGGGTGGTGG + Intronic
922243969 1:223776996-223777018 TGGTGGCGGCGGGGGGGCGGGGG - Intergenic
922271948 1:224043276-224043298 TGCTGGAGGGGAGGGAGGGGAGG - Intergenic
922437746 1:225622960-225622982 TGGTGGGGGTGCTGGAGTGGAGG - Intronic
922757658 1:228105497-228105519 GGGTGGCGGTCAGGGAGTGGAGG + Intergenic
922936543 1:229427163-229427185 TGCTGGCGGAGAGGAGGTGGGGG - Intergenic
924172330 1:241356216-241356238 GGGATGCGGTGGGGGAGTGGGGG + Intronic
924381972 1:243473916-243473938 TGCCGGCGGGGGGGGGGGGGGGG + Intronic
924481600 1:244440015-244440037 TGCTGGGGGTGGGGAAGGGGTGG + Intronic
924648640 1:245903614-245903636 TGCTGGGGGTCAGGGAGAGGTGG - Intronic
924886945 1:248229110-248229132 TGCTGGTTGTGGCAGAGTGGGGG + Intergenic
1062921835 10:1286068-1286090 GGCGGGTGGTGGGGCAGTGGGGG + Intronic
1063157470 10:3393624-3393646 TGCTGGGGGTGGGGTGGGGGTGG - Intergenic
1063580270 10:7300161-7300183 TGCTGGGGGATGGGGAGTGGAGG + Intronic
1063814000 10:9750175-9750197 GGCGGGGGGTGGGGGAGTGGTGG + Intergenic
1064363608 10:14687631-14687653 TGCGGGGGGTGGGGGAGGGCTGG + Intronic
1064553181 10:16522185-16522207 TGCTGGCAGTGGGGAAATCGGGG - Intergenic
1064900232 10:20287970-20287992 TTCTTGCGGCGGGGGAGGGGGGG + Exonic
1065023734 10:21522276-21522298 TGGTGGCGGGGGGGGGGGGGGGG - Intronic
1065025485 10:21535429-21535451 TGCTGACCATGCGGGAGTGGCGG + Intronic
1065040000 10:21683690-21683712 TGTTGGGGATGGGGCAGTGGGGG - Intronic
1065056968 10:21855776-21855798 GGGTGGCGGTGGGGTAGGGGTGG - Intronic
1065486985 10:26245212-26245234 GGCTGGGGTTGGGGGTGTGGGGG + Intronic
1066325064 10:34350627-34350649 TCTTGGCGGGGGGGGAGGGGGGG + Intronic
1066372316 10:34827912-34827934 TTGTGGGGGCGGGGGAGTGGTGG - Intergenic
1066469846 10:35687883-35687905 TGGTGGCGGGGCGGGGGTGGGGG + Intergenic
1067053714 10:43039599-43039621 TGCTGGCGGTGGGGGCGGGGGGG - Intergenic
1067453180 10:46394967-46394989 TGCTGGCAGGGAGGCAGTGGGGG - Intergenic
1067584055 10:47464799-47464821 TGCTGGCAGGGAGGCAGTGGGGG + Intronic
1067667400 10:48289991-48290013 TGCTGGAGGAGGGGGCCTGGTGG + Intergenic
1067760062 10:49038446-49038468 GGCTGGCTGGGTGGGAGTGGGGG + Intronic
1067830055 10:49606384-49606406 TGCTGGGGATGGGGGAGTCCTGG - Intergenic
1068019034 10:51557340-51557362 TGTGGGTGGTGGGGGGGTGGTGG - Intronic
1068104091 10:52592026-52592048 TCCTGGGGTTGGGGGAGGGGAGG + Intergenic
1068246495 10:54378000-54378022 AGCTTGGGGTTGGGGAGTGGAGG - Intronic
1068474204 10:57505220-57505242 GGCTGGGGGTGGGGGAATGAGGG - Intergenic
1068540839 10:58293511-58293533 TGGTGGGGGTGGGGGAAAGGGGG + Intergenic
1068652140 10:59534197-59534219 TGTTGGGGGGTGGGGAGTGGGGG + Intergenic
1068877598 10:62013575-62013597 GGCTGGAGTTGGGGGAGTTGGGG - Intronic
1068925090 10:62527589-62527611 TGCTGTTGGTGGGGGCATGGTGG - Intronic
1068956190 10:62819929-62819951 TGCTGGAGGTGGAGGGGTGTGGG + Intronic
1069588892 10:69630109-69630131 TGCTGGGGGTCGGGGAGATGGGG - Intergenic
1069604608 10:69731554-69731576 TGATGGTGGAGGGGGTGTGGTGG + Intergenic
1069699598 10:70412382-70412404 TGATGGCGGCCGGGGGGTGGGGG + Intronic
1069782717 10:70966919-70966941 TGCTGGAGGTCTGGGAGTGATGG + Intergenic
1069834414 10:71299591-71299613 GGCTGAGGGTGGGGGGGTGGAGG - Exonic
1069997846 10:72354091-72354113 TGCGGGCGATGGAGGACTGGCGG + Intronic
1070286118 10:75085159-75085181 TGGTGGCGGTGCGTGGGTGGCGG + Intergenic
1070391391 10:75973784-75973806 TGGGGGCGGTGGGGTAGTGGGGG + Intronic
1070410372 10:76134006-76134028 TGTTGGGGGTGGGGGAGGTGAGG - Intronic
1070507458 10:77126720-77126742 TGGTGGTGGGGGGGGGGTGGGGG - Intronic
1070804753 10:79264529-79264551 TGCTGGCGGCAGGGCAATGGCGG - Intronic
1070831382 10:79420070-79420092 TGCTGGGGGTGGAGCAGGGGTGG - Intronic
1071530916 10:86389857-86389879 TGCTGGCGGCTGCGGAGTCGCGG + Intergenic
1071819516 10:89265207-89265229 TGCAGGGGGTTGGGGAGTGGGGG + Intronic
1071869879 10:89781831-89781853 TGCTGGGGGTGCGGGAAGGGTGG + Intergenic
1072021839 10:91410293-91410315 CGCGGGCGGGGGCGGAGTGGCGG + Exonic
1072161757 10:92773744-92773766 TGTTGGAGGTAGGGGAGTGGAGG - Intergenic
1072164597 10:92800769-92800791 TGCTGGTGGTGGTGGGGGGGTGG + Intergenic
1072795545 10:98351867-98351889 TACTGGGGGTGGGGCAGGGGTGG - Intergenic
1073025219 10:100482644-100482666 GGCTGGCGGTGGAGGAGCGCCGG + Exonic
1073082015 10:100866306-100866328 TGCTGTGTGTGGGGAAGTGGAGG - Intergenic
1073098949 10:100997223-100997245 AGGTGGCGCTGGGTGAGTGGTGG + Intronic
1073267245 10:102235174-102235196 GGGAGGCGGTGGGGGGGTGGGGG - Intronic
1073289891 10:102408412-102408434 TGCTGGGGGCGGTGGAGTGGGGG - Intronic
1073459485 10:103658467-103658489 GCCTGACGGTGGGGGAGAGGAGG - Intronic
1073559767 10:104486859-104486881 TGCTGTGGGTTGGGGAGAGGAGG + Intergenic
1074011784 10:109489715-109489737 TGCTGGAGGTGGGGGCCTGATGG - Intergenic
1074241712 10:111645965-111645987 TGGAGTCGGTGGGGGAGGGGGGG + Intergenic
1074426372 10:113355029-113355051 TGGAGGAGGTGGGGGAGGGGAGG + Intergenic
1074649919 10:115509374-115509396 TGTTGGAGGTGGGGGCCTGGTGG + Intronic
1074778692 10:116785194-116785216 TGGTGGCGGTGGGTGGGAGGGGG - Intergenic
1074801377 10:117004743-117004765 TGCTGGCGATCGGGGGCTGGGGG - Intronic
1074876082 10:117614412-117614434 TAGTGGGGGTGGGGGGGTGGCGG + Intergenic
1074898899 10:117800274-117800296 TGCTGGGGGGGGGGGAGGTGGGG - Intergenic
1074938082 10:118206737-118206759 TGAAGGGGGTGGGGGAGTGGTGG - Intergenic
1075062512 10:119266744-119266766 TGCTGGGGTTGGGTGGGTGGGGG + Intronic
1075266383 10:121002497-121002519 TGCTGGGGGTGGGAGGGTGCCGG + Intergenic
1076005307 10:126944121-126944143 TGATGGTGGTGGGGGTGGGGAGG + Intronic
1076650136 10:131981867-131981889 TGCGGGCGGTGGGAAAGCGGAGG + Exonic
1076710610 10:132331911-132331933 CGCTTGCGGTGGGGGGGTTGTGG - Intergenic
1076949516 10:133670149-133670171 TGGTGGTGGGGGGGGGGTGGTGG - Intronic
1076949517 10:133670152-133670174 TGGTGGTGGTGGGGGGGGGGTGG - Intronic
1076950500 10:133673448-133673470 TGGTGGTGGGGGGGGGGTGGTGG - Intergenic
1076950501 10:133673451-133673473 TGGTGGTGGTGGGGGGGGGGTGG - Intergenic
1076953463 10:133683367-133683389 TGGTGGTGGGGGGGGGGTGGTGG - Intergenic
1076953464 10:133683370-133683392 TGGTGGTGGTGGGGGGGGGGTGG - Intergenic
1076958398 10:133752947-133752969 TGGTGGTGGGGGGGGGGTGGTGG - Intergenic
1076958399 10:133752950-133752972 TGGTGGTGGTGGGGGGGGGGTGG - Intergenic
1076960371 10:133759556-133759578 TGGTGGTGGGGGGGGGGTGGTGG - Intergenic
1076960372 10:133759559-133759581 TGGTGGTGGTGGGGGGGGGGTGG - Intergenic
1077014340 11:393232-393254 TGGTGGGGGTGGGGTAGTGGGGG - Intronic
1077182461 11:1222865-1222887 TGCTGGGGGTGGGGGCGTCCTGG + Intergenic
1077184433 11:1229928-1229950 CGCCTGCGGTGGGGGTGTGGAGG + Intronic
1077191656 11:1258241-1258263 TGCTGGGGGTGGGGGAGTGCAGG + Intronic
1077235100 11:1478173-1478195 TGGTGGCGGTGGGGCTGTGGCGG - Intronic
1077300922 11:1846571-1846593 TGCTGGGGCTGGGGGAGAGTCGG - Intergenic
1077309697 11:1882894-1882916 TGCCGGCTGCGGGGGAGGGGAGG - Intronic
1077368291 11:2170092-2170114 TGGTGGTGGGGGAGGAGTGGGGG + Intronic
1077417079 11:2429162-2429184 TGATGGTGATGGGGTAGTGGTGG + Intergenic
1077504759 11:2924803-2924825 GGCAGGGGGTGGGGGACTGGAGG + Intronic
1077841632 11:5982167-5982189 TGCTGGCAGTGGCAGAGTGATGG + Intergenic
1077919451 11:6631879-6631901 AGCTGGTGTTTGGGGAGTGGGGG + Intronic
1077957090 11:7031957-7031979 TGCTGGAGTAGAGGGAGTGGGGG - Intronic
1078054103 11:7993071-7993093 TGCTTGGGGTGGGGGAGGGATGG - Intronic
1078082921 11:8217176-8217198 TGCTGGAGGTGGGGGTGGGTGGG + Intergenic
1078145268 11:8718108-8718130 GGCTGGGGGTGGGGGGTTGGGGG - Intronic
1078168998 11:8914311-8914333 TCCTGCGCGTGGGGGAGTGGAGG - Intronic
1078415136 11:11158385-11158407 GGCGGGCGGTGGGGGGGGGGAGG + Intergenic
1078535941 11:12174350-12174372 GGCTGGGGGTGGGGGTGGGGAGG - Intronic
1078592591 11:12657565-12657587 TGCTGGCGGTGCTGGGTTGGGGG + Intergenic
1078743791 11:14091912-14091934 TGCTGGGGGTGGCGGGGCGGGGG + Intronic
1078906246 11:15690598-15690620 TGGTGGGGGTTGGGGGGTGGGGG + Intergenic
1078933650 11:15933768-15933790 TGGTGGTGGTGGTGGGGTGGTGG - Intergenic
1079028664 11:16968711-16968733 TGTTGGTGGTGGGGGAGTCATGG - Intronic
1079399299 11:20092968-20092990 TGCAGGGGGTGGGGGGGTAGGGG - Intronic
1080256436 11:30295675-30295697 TGCTGGCAGTGGTGATGTGGGGG - Intergenic
1080489980 11:32751648-32751670 TGCAGGGGCTGGGGGAGGGGTGG + Intronic
1080605605 11:33862381-33862403 TGCTGGGAGTGGTGGGGTGGCGG - Intronic
1080642650 11:34166730-34166752 TGCTGGCGTGGGGACAGTGGTGG - Intronic
1080689347 11:34543251-34543273 TGCTGGGGGTTGGCGGGTGGCGG + Intergenic
1080768339 11:35317347-35317369 GGCTGGGGGTGGGGTAGTGCAGG + Intronic
1080979647 11:37385890-37385912 TGCTGGTGGTGGGGGGCGGGGGG + Intergenic
1081636972 11:44727564-44727586 TGCTCCGGGTGGAGGAGTGGGGG + Intronic
1081670382 11:44939062-44939084 TGCTGGCGGTGGGGGAGTGGGGG - Intronic
1082010751 11:47448409-47448431 GGCTGGGGGTGGGTGGGTGGTGG - Intronic
1083147066 11:60767713-60767735 TGGTGGGGGTGGGCGCGTGGGGG - Intronic
1083265797 11:61546297-61546319 GGGTGGCGGTGGGGGAGAGAGGG + Intronic
1083702306 11:64487460-64487482 GGCAGGGGGTGGGTGAGTGGGGG + Intergenic
1083713848 11:64564672-64564694 TGCTGGTGGTGATGGAGTGATGG - Intronic
1083714538 11:64567983-64568005 TGCTGAGGGTGGGAGACTGGGGG + Intronic
1083737036 11:64687307-64687329 TGGTGGCGGGGGGGGAGTTTCGG + Intronic
1083744262 11:64726490-64726512 TGCTGGCTGTCGGGGAAGGGAGG - Intergenic
1083872599 11:65498324-65498346 TGCGGGCCGTGGGGGGCTGGCGG + Intergenic
1084192418 11:67505072-67505094 TGCTCGCGGGGTGCGAGTGGGGG - Intronic
1084859945 11:72011788-72011810 AGATGGGGGCGGGGGAGTGGGGG - Intronic
1085038465 11:73313303-73313325 TTCTGAAGGTGGGGGAGGGGAGG + Intronic
1085050062 11:73375810-73375832 TGCGGGGAGTAGGGGAGTGGAGG + Intergenic
1085265137 11:75233154-75233176 TGTTGGTGGTGGGAGAGTGGGGG - Intergenic
1086085496 11:82950518-82950540 TGTTGGGGGTGGGGGTCTGGGGG - Intronic
1086093539 11:83027808-83027830 TACTTGCGGCTGGGGAGTGGGGG - Intronic
1086158085 11:83690672-83690694 TGCTGTGGGTGGGGGTGGGGGGG + Intronic
1087548858 11:99620705-99620727 TGATGGCCGGGGGGGAGCGGGGG - Intronic
1087559666 11:99771637-99771659 AGCTGGCGGTGGGGGAAATGAGG + Intronic
1087779473 11:102287369-102287391 AGTTGGCGGAGGGGGAGGGGGGG + Intergenic
1088821533 11:113461360-113461382 TGCTGGGGGTGGTGGATGGGAGG - Intronic
1088920633 11:114257857-114257879 CGCGGGCGCTGGGGGAGAGGAGG + Exonic
1089171004 11:116511450-116511472 GGGTGGGGGTGGGGGTGTGGGGG + Intergenic
1089352557 11:117829682-117829704 TACTGGCGGTGTGGGTGGGGGGG - Intronic
1089377349 11:118003981-118004003 TTCTGGAGGTGGGGAAGTGCAGG + Intergenic
1089534850 11:119154640-119154662 AGCTGGGAGTGGGAGAGTGGTGG + Intronic
1090136498 11:124204484-124204506 TGCTGGGGGTGGGGGAGGAGTGG + Intergenic
1090270738 11:125384324-125384346 GTTTGGCGGTGGGGGAATGGGGG + Intronic
1090355977 11:126140563-126140585 TCCTGGCGGGTGGGGAATGGGGG + Intergenic
1090636285 11:128692435-128692457 TGTTGGGGGTGGGGGTGGGGTGG - Intronic
1091315605 11:134611815-134611837 TGCTGGTGGTGGAGCACTGGTGG + Intergenic
1091315612 11:134611841-134611863 TGCTGGTGGTGGAGCACTGGTGG + Intergenic
1091586959 12:1822061-1822083 TTCTGCCGGTGGGGAGGTGGGGG - Intronic
1091632668 12:2173707-2173729 TGGTGGCAGTGGGGCAGTTGTGG - Intronic
1091670615 12:2449654-2449676 TGCATGCTGTGTGGGAGTGGTGG - Intronic
1091918792 12:4288179-4288201 TGCAGGGAGTGGGCGAGTGGGGG - Intronic
1091991844 12:4961851-4961873 TGATGGAGGTGGGGAAGAGGAGG + Intergenic
1092161716 12:6318724-6318746 AGCTGGGGGTGGGGGCGTAGGGG - Exonic
1092443220 12:8527719-8527741 TCCTGGGGGTGGGGGAGCGCGGG - Intergenic
1092513938 12:9187945-9187967 TGATGGGGGTGGGGTGGTGGTGG + Intronic
1093357201 12:18180223-18180245 GGTTGGGGGTGGGGGTGTGGCGG + Intronic
1093478581 12:19582012-19582034 TCCTGGTGGTGGAGGTGTGGGGG + Intronic
1093894539 12:24562116-24562138 GGCTGGGGGTGGCGGAGAGGTGG - Intergenic
1094448406 12:30558597-30558619 TGGTGGCGGGTTGGGAGTGGCGG + Intergenic
1094565930 12:31598371-31598393 TGGCGGGGGTGGGGGGGTGGTGG + Intergenic
1095099657 12:38166797-38166819 TGCTGGGGGTGAGGAAATGGTGG + Intergenic
1095264382 12:40136701-40136723 TAGTGGGGGTGGGGCAGTGGGGG - Intergenic
1095953722 12:47795235-47795257 GCCCGGCGGTGGGGGAGCGGTGG + Exonic
1096155137 12:49337309-49337331 TAGGGGCAGTGGGGGAGTGGAGG - Intergenic
1096518602 12:52171712-52171734 TCCTGGGGGTGGGGGACGGGGGG + Exonic
1096531440 12:52244997-52245019 GGCTGGGGCTGGGGGACTGGGGG + Intronic
1096673656 12:53214860-53214882 TGCAGGAGCTGGGGGAGGGGGGG + Intronic
1096786352 12:54019172-54019194 TACTGGGGGTGGGGGGGTGGGGG - Intronic
1096902517 12:54900019-54900041 AGGTGGCGGTGGGGGTGGGGTGG + Intergenic
1097161349 12:57048568-57048590 TGGTGGGGGTGGGGCAGGGGTGG + Intronic
1097714969 12:62956030-62956052 TGCAGGGGATAGGGGAGTGGTGG + Intergenic
1098058291 12:66532765-66532787 TGGTGGTGGTGGTGAAGTGGAGG - Intronic
1098415498 12:70230216-70230238 TGGTGGTGGTGAGGTAGTGGTGG + Intergenic
1098932440 12:76435384-76435406 TGCTAGAGGTTGGGGAGTGGAGG + Intronic
1099165953 12:79307612-79307634 GGCTGGGGGTGGGGGTGGGGGGG + Intronic
1099392472 12:82098022-82098044 TGCTGGTGGTGGGGGCATGGTGG - Intergenic
1099477197 12:83121995-83122017 TGCTGTTGGTGGGGGCATGGTGG - Intronic
1099610153 12:84857681-84857703 GCCTGGGGTTGGGGGAGTGGTGG + Intergenic
1099669336 12:85670240-85670262 TGCTGTCTGTTAGGGAGTGGTGG + Intergenic
1100535315 12:95503430-95503452 TGCTGAGTGTGAGGGAGTGGAGG + Intronic
1100632330 12:96400686-96400708 TGCGGGCGTCGGGGGAGCGGCGG + Intergenic
1101245909 12:102884271-102884293 TGCTGGGTGTTGGGGACTGGGGG + Intronic
1101445446 12:104733998-104734020 TGCTGGTGGTGGCGGGGAGGAGG - Intronic
1101468441 12:104971914-104971936 TGCTTGAGTTGGGGAAGTGGAGG + Intergenic
1101548066 12:105735502-105735524 TGGTGGGGGTGGGGGGGTGGGGG + Intergenic
1101579829 12:106032699-106032721 TGGTGGTGGTGGTGGGGTGGGGG - Intergenic
1101674762 12:106907794-106907816 TCCTGGAGGTGGGGGTCTGGGGG + Intergenic
1102050150 12:109856216-109856238 TGCTGAGGGCTGGGGAGTGGAGG - Intronic
1102462693 12:113109820-113109842 AGATGGCAGTGGGGTAGTGGTGG - Intronic
1102601303 12:114032673-114032695 TGGTGGTGGTGGTGGTGTGGGGG + Intergenic
1102625910 12:114235342-114235364 TGGTGGCTGGGGAGGAGTGGTGG - Intergenic
1102716068 12:114973837-114973859 TGTTGGGGGTGGGGGTGGGGGGG + Intergenic
1103021720 12:117539807-117539829 TGCTGGCGAGGAGGGCGTGGAGG + Exonic
1103196140 12:119045297-119045319 TGCTGGCTGTGAGGAAGGGGCGG - Intronic
1103286113 12:119803124-119803146 AGGTGGTGGTGGGGGGGTGGGGG - Intronic
1103538892 12:121652615-121652637 GGCTTGGGGTCGGGGAGTGGGGG - Intronic
1103563610 12:121804753-121804775 TGCTGGTGGTGGTGGTGGGGGGG - Exonic
1103565429 12:121812944-121812966 TGAAGGCTGAGGGGGAGTGGGGG - Intronic
1104050582 12:125191046-125191068 TGGTGGTGGTGGGGAAGGGGTGG + Intronic
1104092850 12:125530330-125530352 AGTTGGGGGTCGGGGAGTGGAGG - Intronic
1104228155 12:126857314-126857336 GGGTGGCGGTGGGGTGGTGGGGG - Intergenic
1104370504 12:128219982-128220004 TGGTGGAGGGGAGGGAGTGGAGG + Intergenic
1104835369 12:131786713-131786735 CACTGGGGGTGGGGGGGTGGTGG - Intronic
1105304927 13:19161595-19161617 TGGAGGAGGTGGGGGAGTAGGGG + Intergenic
1105708537 13:22983411-22983433 TGCTGCTGGTGGGGGAGGGCAGG - Intergenic
1105740971 13:23322774-23322796 TGTTGGCGGGGGGGGGGGGGGGG - Intronic
1105930811 13:25049770-25049792 TGGTGGAGGTGGTGGGGTGGGGG - Intergenic
1105956558 13:25288240-25288262 TGGTGGTGGTGGGGGGGTGGCGG + Intergenic
1105989447 13:25603603-25603625 TGATGGGGGTGTTGGAGTGGAGG + Intronic
1106160407 13:27196308-27196330 AGCAGGCGCTGGGGGAGAGGAGG - Intergenic
1106509315 13:30399291-30399313 TGATGGGGCTGGGAGAGTGGGGG - Intergenic
1107133556 13:36920481-36920503 GGCTGGGGGTGGGGAAGAGGCGG - Intronic
1107228250 13:38076738-38076760 TACTGGGGGTGGGAGAGGGGTGG - Intergenic
1107555307 13:41512682-41512704 TACTGGCTGTGGAGGAGAGGTGG + Intergenic
1107600083 13:42004320-42004342 TATTGGCTGTGTGGGAGTGGAGG - Intergenic
1107718324 13:43222303-43222325 GGCTGGCGGGGAGGGGGTGGCGG - Intronic
1108355514 13:49625754-49625776 TCCTGGGGGTGGGGGAGCTGGGG - Intergenic
1108359038 13:49652607-49652629 TGCTGGGGGTGGGGGGGGGGGGG + Intergenic
1108575874 13:51790161-51790183 AGCTGGGGGTGGGGTAGTGGAGG - Intronic
1108690047 13:52851399-52851421 TGCCGGCGGTGGAGGTGTGAAGG + Intergenic
1109291985 13:60487580-60487602 TGCTGGGAGTGGGAGAGTGGTGG + Intronic
1110193595 13:72759942-72759964 AGCTGGCAGTGGGGAAGGGGAGG - Intronic
1111240434 13:85466302-85466324 TGCTGGGTGGGGGGGAGTGGGGG + Intergenic
1111639238 13:90946974-90946996 GCCTGGGGTTGGGGGAGTGGTGG - Intergenic
1111698732 13:91659737-91659759 TGGAGGCGGTGGGGGACAGGTGG - Intronic
1112067726 13:95812625-95812647 TGCTGGAGGTGGGGGCTTGGTGG + Intronic
1112124877 13:96454053-96454075 AGCTAGGGGTGGGGGAGTGGTGG - Intronic
1112349789 13:98623192-98623214 TGCTGGCCCTGGGGGAATGCTGG - Intergenic
1113055166 13:106259841-106259863 TGCTTGGTGTGGGGGTGTGGGGG + Intergenic
1113772694 13:112920705-112920727 TGCTGGTGGTGGGTGGGCGGGGG + Intronic
1113810880 13:113141694-113141716 TGCTGGCCGTGTGGAAGTGCCGG - Intronic
1113944692 13:114037478-114037500 GGCTGCCGGTGGGGAAGGGGCGG + Intronic
1113966414 13:114155824-114155846 TGCTGGGCGTGGGGGAGGGGGGG + Intergenic
1114212557 14:20627463-20627485 TTGTGGCGGTGGGTGGGTGGGGG - Intergenic
1114346994 14:21806879-21806901 TGTCGGGGGAGGGGGAGTGGGGG + Intergenic
1114544331 14:23487401-23487423 TGCTGTTGGTGGGGGGGGGGGGG + Intronic
1114633017 14:24171784-24171806 GGCTTGCGGCGGGGGAGCGGCGG + Intergenic
1114834173 14:26184013-26184035 TGTTGGGGCCGGGGGAGTGGGGG - Intergenic
1116551237 14:46241521-46241543 TACTGGCGAGGGGTGAGTGGTGG - Intergenic
1116554272 14:46283782-46283804 TGTTGGGGGTGGGGGGGTGGGGG - Intergenic
1116725275 14:48554788-48554810 TGCTGGGGGTGTGGGAGGGGTGG + Intergenic
1116958443 14:50946258-50946280 TGGTGGTGGTGGGGGGGGGGGGG + Intergenic
1117265028 14:54077452-54077474 TGCTGGGTGTGGTGGAGGGGTGG + Intergenic
1117377755 14:55130744-55130766 TGGTGGTGGTGGGGGGGGGGGGG + Intronic
1118179626 14:63479288-63479310 TGCTGTGGGTGGGGGAGGAGGGG + Intronic
1118303960 14:64639067-64639089 TGCAGGGGGTGGGGGAATGGAGG + Intergenic
1118871392 14:69745780-69745802 GGCTGGGGGTGGGGGGGTGCGGG + Intronic
1119439528 14:74619020-74619042 GGCTGGGGGTGGAGGGGTGGAGG + Intergenic
1119505273 14:75167421-75167443 TGGTGGGGGTGGGGGCGAGGAGG - Intronic
1119724360 14:76913335-76913357 TCCCCGGGGTGGGGGAGTGGGGG + Intergenic
1119748578 14:77061840-77061862 TGCAGGTGGGGCGGGAGTGGGGG + Intergenic
1120915107 14:89703599-89703621 TGTTGGAGGTGGGGGCCTGGTGG - Intergenic
1121337443 14:93085981-93086003 TGACGGAGGAGGGGGAGTGGGGG - Intronic
1121900377 14:97688403-97688425 TGCGGGAGCTGGGGAAGTGGGGG - Intergenic
1122176907 14:99927800-99927822 TGGGGGGGGTGGGGGGGTGGTGG + Intronic
1122338369 14:101008309-101008331 TGCCGGCGGAGGGGGGGTTGCGG + Intergenic
1122349128 14:101077584-101077606 GGCAGGCGGGGGCGGAGTGGGGG + Intergenic
1122422894 14:101588642-101588664 TGCTGGGGGTGGGAGTGGGGGGG - Intergenic
1122573761 14:102727285-102727307 TCTTGGAGGTGGGGGGGTGGGGG - Exonic
1122631654 14:103109969-103109991 TGCTGGGGCTGGGGGTGTTGCGG + Intronic
1122637683 14:103138085-103138107 AGCTGGGGGTGGGGGAGGGCAGG + Intergenic
1122736758 14:103847762-103847784 TCCCGGCGGCGGGGGAGGGGCGG + Intergenic
1122819325 14:104333328-104333350 TGCTGGAGGTAGGGGTGTGGAGG - Intergenic
1122863909 14:104594978-104595000 TGCAGGAGGTGGGGGAGAGCTGG - Intronic
1122974076 14:105163936-105163958 TGCTGCTGGTGGTGGAGTGGGGG - Intronic
1123450566 15:20357078-20357100 TGATGGGGGTGGGGGAGGAGGGG + Intergenic
1124209049 15:27747132-27747154 TGTTGGTGGTGGGGGGCTGGAGG - Intergenic
1124452761 15:29811425-29811447 GGGTGGGGGTGGGGGGGTGGTGG + Intronic
1124646511 15:31440965-31440987 GGCTGGGGGTGGGAGGGTGGGGG + Intergenic
1125599467 15:40907397-40907419 TGGTGGAGGTGGGGCTGTGGTGG - Intergenic
1125603485 15:40927843-40927865 TGGTGGTGGTGGAGGACTGGGGG - Intergenic
1125744295 15:41988231-41988253 TGCGTGGGGTGGGGGGGTGGGGG - Intronic
1126144275 15:45462136-45462158 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144294 15:45462208-45462230 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144343 15:45462408-45462430 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144381 15:45462565-45462587 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144430 15:45462765-45462787 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144481 15:45462977-45462999 TGATGGTGGTGGTGGTGTGGTGG - Intergenic
1126144519 15:45463123-45463145 TGATGGTGGTGGTGGTGTGGTGG - Intergenic
1126144533 15:45463178-45463200 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126195185 15:45923316-45923338 TGATGGTGGTGGAGGTGTGGAGG + Intergenic
1126318634 15:47398022-47398044 TGTTGGGGGTTGGGGAATGGAGG - Intronic
1126319612 15:47407919-47407941 TGGTGGTGGTGGTGGGGTGGGGG + Intronic
1126348411 15:47719149-47719171 TGGCGGGGGTGGGGGTGTGGAGG + Intronic
1126408306 15:48345490-48345512 TGCTGGAGGTAGGAGAGGGGAGG - Intergenic
1126517741 15:49554655-49554677 TGCTGGGGGTTGGGGAGGGGTGG + Intronic
1126604800 15:50465338-50465360 TGTGGGTGGTGGGGGAGGGGAGG + Intronic
1126835939 15:52664941-52664963 TGTTGGGGGTGGGGGGGTGCAGG + Intronic
1126849268 15:52787627-52787649 GGTGGGGGGTGGGGGAGTGGGGG + Intronic
1127251854 15:57247145-57247167 TGGTGGTGGTGGTGGAGTGACGG - Intronic
1127314150 15:57778748-57778770 TGTTGGGGGTGGGAGAGTGATGG - Intronic
1127396466 15:58547381-58547403 TGCAGGCAGTGGAGGAGCGGAGG + Intronic
1127515517 15:59689379-59689401 TGGAGGCGGCGGGGGCGTGGCGG + Exonic
1127648516 15:60983006-60983028 GACTGGCGGGTGGGGAGTGGGGG + Intronic
1127890129 15:63242861-63242883 TGGTGGTGGTGTGGGGGTGGGGG + Intronic
1128094254 15:64941931-64941953 TACTGGGGGTGGGGACGTGGTGG + Intronic
1128253432 15:66179808-66179830 TGGTGGGGGTGGGGGGGTGGTGG - Intronic
1128311139 15:66632315-66632337 GGCTGGGGGTGGGAGACTGGGGG + Intronic
1128559251 15:68653808-68653830 TGCTGATTGTGGGGGAGTGATGG - Intronic
1128877474 15:71214263-71214285 TGCTGGCTGGGAGGGACTGGAGG - Intronic
1129113614 15:73352701-73352723 TGGTGGAGGTGGGGTAGAGGAGG - Intronic
1129356544 15:74995806-74995828 TGCTGGAGAGGTGGGAGTGGAGG + Intronic
1129465359 15:75721693-75721715 CCCTGGGGGTGGGGGAGAGGGGG + Intergenic
1129505714 15:76079822-76079844 TTAGGGCGGTGGGGGGGTGGGGG + Intronic
1129674304 15:77624273-77624295 AGCTGGGGGCCGGGGAGTGGGGG - Intronic
1129676106 15:77633011-77633033 TGATGGTGGTGGTGGGGTGGGGG + Intronic
1129718334 15:77864594-77864616 GCCTGGCGGTGGGGTAGCGGGGG + Intergenic
1129862317 15:78872599-78872621 AGCTGGCGATGGGGGAGAGTGGG - Intronic
1129862521 15:78873410-78873432 TGGCGGCGGGGGGGGAGGGGCGG + Intronic
1129917424 15:79286213-79286235 TGATGGTGGGGGTGGAGTGGGGG + Intergenic
1130042259 15:80414871-80414893 TGCTGGTGGTGGTGGTGTGGTGG + Intronic
1130054078 15:80507360-80507382 TGCAGGCGGTGAGGGAGAGGAGG + Intronic
1131009309 15:89004164-89004186 TTCTGGAGGTTGGGGGGTGGAGG - Intergenic
1131035915 15:89221923-89221945 TGGTGGTGGTGGGGGGGGGGGGG - Intergenic
1131153679 15:90062245-90062267 TGCTGGGAGTGGGGGAAGGGAGG - Intronic
1131279583 15:91009702-91009724 AGCTGGTGGTGGGGGTGGGGTGG + Intronic
1131832743 15:96364642-96364664 TGGTGGTGGTGGGGGTGGGGTGG + Intergenic
1131927238 15:97399108-97399130 TGGTGGCCTTGGTGGAGTGGTGG + Intergenic
1132403146 15:101526218-101526240 GGCTGGGAGTGGGGGAGCGGGGG - Intergenic
1132522403 16:397654-397676 GGGTGGGGGTGGGGGTGTGGGGG + Intronic
1132522424 16:397692-397714 GGGTGGGGGTGGGGGTGTGGGGG + Intronic
1132674625 16:1116616-1116638 TGCTGGCGGTGGGCATGTGAGGG - Intergenic
1132682252 16:1147521-1147543 GGCTGGGGGAGGGGGGGTGGGGG - Intergenic
1132934909 16:2475256-2475278 TGCTGGGGGCGGGAGCGTGGGGG + Intronic
1133069407 16:3235593-3235615 GTAGGGCGGTGGGGGAGTGGCGG - Intronic
1133234599 16:4382055-4382077 TACAGTCGGTGGGGCAGTGGAGG - Exonic
1133292964 16:4734758-4734780 GGCTGGGGGTGGGTGAGAGGAGG + Intronic
1133421433 16:5650335-5650357 TGGTGGTGGTGGTGGTGTGGAGG + Intergenic
1133745062 16:8680081-8680103 GGCTGGAGGTGGGGGAGGGTCGG - Intronic
1134245023 16:12533454-12533476 TGCTGGGGATGGGGGTGGGGAGG - Intronic
1134256743 16:12618698-12618720 TGGTGGTGGTGGGGGGATGGGGG - Intergenic
1134617664 16:15664114-15664136 TGGAGGGAGTGGGGGAGTGGGGG - Intronic
1135063504 16:19290338-19290360 TGGTGGGGGAGGGGAAGTGGAGG - Intronic
1135164430 16:20126242-20126264 TGGTGGTGGTGGTGGTGTGGTGG + Intergenic
1135290142 16:21229410-21229432 AGCGGGGGGTGGGGAAGTGGGGG - Intergenic
1135298011 16:21300270-21300292 TGATAGGAGTGGGGGAGTGGAGG + Intronic
1135380223 16:21989883-21989905 TGCTGGAGGTGGGGACATGGGGG - Intronic
1135784557 16:25337065-25337087 TGGTGGGGTGGGGGGAGTGGGGG - Intergenic
1135995457 16:27244521-27244543 AGCTTGGTGTGGGGGAGTGGGGG - Intronic
1136251474 16:29008403-29008425 TGCTGGCTCTGGGGCTGTGGGGG + Intergenic
1136262930 16:29093537-29093559 TGTTGTTGGTGGGGGACTGGTGG - Intergenic
1136409351 16:30067110-30067132 TGCTGGGTGTGGGGCAGGGGAGG + Intronic
1136414778 16:30096350-30096372 AGCGGGCGGCGGGGGAGGGGCGG - Intronic
1136629812 16:31483294-31483316 TGCTGGCTTTGGGGGCCTGGGGG + Intronic
1137057004 16:35750747-35750769 TGCAGGTGGTGGGAAAGTGGGGG - Intergenic
1137831232 16:51545272-51545294 TGGTGGGGGAGGGTGAGTGGTGG + Intergenic
1138252319 16:55510443-55510465 TGCGGGGGTTGGGGGGGTGGGGG + Intronic
1138446975 16:57070671-57070693 TGGTGGAAGTGGGTGAGTGGTGG + Intronic
1138446985 16:57070708-57070730 TGGTGGAAGTGGGTGAGTGGTGG + Intronic
1138542197 16:57695227-57695249 TGGTGGGGGTGGGGGAGTGGTGG - Intronic
1138620432 16:58206740-58206762 TGGTTGGGGTTGGGGAGTGGTGG - Intergenic
1139364506 16:66425677-66425699 TGCAGGAGGGCGGGGAGTGGGGG + Intergenic
1139369987 16:66461021-66461043 TGCTGGCATTGGGGGGGAGGTGG + Intronic
1139426222 16:66881286-66881308 GGCAGGGGGTGGGGGAGTGAAGG + Intronic
1139547057 16:67654266-67654288 TGCTGGGGGTGGGAGAGGGTGGG + Intronic
1139696792 16:68680810-68680832 TCCTGGCAGTGGGTGAGGGGTGG + Intronic
1139872581 16:70119328-70119350 TTTTGGCGGTGGGGGGTTGGGGG - Intronic
1139987945 16:70915986-70916008 TGCTGTTGGTGGGGGCATGGTGG - Intronic
1140020378 16:71232889-71232911 TGGTGGCGGCGGGGGGGGGGGGG + Intergenic
1140205941 16:72933633-72933655 TGCTGGAGTAGGGGGAGGGGTGG - Intronic
1140442281 16:74997626-74997648 GGCTGGGGGTGGGGGGGTGGGGG - Intronic
1140462123 16:75148522-75148544 CGCTGGTGGTGGGGGAAGGGCGG - Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1140941223 16:79723219-79723241 GGCTGGTGGTGGGGTGGTGGTGG + Intergenic
1141124716 16:81392897-81392919 TGCTGGGGGTCGGGGGGAGGTGG - Intergenic
1141157741 16:81609184-81609206 TGCTGGCTGTGGTGGGGAGGGGG - Intronic
1141253710 16:82381891-82381913 TGGTGGCGGGGGGAGTGTGGTGG + Intergenic
1141284232 16:82656176-82656198 AGCTGGCAGTGTGGGAGTGGGGG + Intronic
1141614884 16:85204809-85204831 GGCTGGGTGTGGGGGACTGGGGG - Intergenic
1141624233 16:85253064-85253086 TGGTGGGGGGGGGGGGGTGGGGG - Intergenic
1141624236 16:85253067-85253089 TGCTGGTGGGGGGGGGGGGGTGG - Intergenic
1141682723 16:85553780-85553802 TGGAGGAGATGGGGGAGTGGGGG - Intergenic
1141684670 16:85563492-85563514 TGCTGGGGCTGGGGGATTGCGGG + Intergenic
1141720357 16:85752198-85752220 TGTTAGAGGCGGGGGAGTGGGGG - Intergenic
1141742945 16:85906331-85906353 TGCTGGCGGCAGGGGTGGGGGGG + Intronic
1141792811 16:86248382-86248404 GGCTGGAGATGGGGGAGGGGAGG - Intergenic
1142026966 16:87819623-87819645 TGGCGGCGGTGGGGGGGGGGGGG + Intergenic
1142264841 16:89058874-89058896 GGCCGGCGGCGGGGCAGTGGGGG + Intergenic
1142265656 16:89063003-89063025 TGCTAGCGGTGGGGGGCAGGTGG - Intergenic
1142478547 17:204373-204395 TGGTGGGGGTGGGTGGGTGGAGG - Intergenic
1142511794 17:400616-400638 TGGTGGGGGTTGGGGAGTCGGGG - Intergenic
1142670612 17:1485902-1485924 TGGTGGAGGTGGGGGTGTCGGGG + Intronic
1142811173 17:2396300-2396322 TGCTGGTGGTGGGGATGTTGGGG - Intronic
1142856114 17:2731338-2731360 TGGTGGAGTTGGGGGAGTGGGGG - Intergenic
1143123341 17:4624017-4624039 TACTGGCAGTGGGGGTGGGGAGG + Intergenic
1143181230 17:4985813-4985835 GGCTGGAGGAGGGTGAGTGGGGG - Intronic
1143184623 17:5002858-5002880 TGCATCCGGTGGGGGAGTGGGGG - Intronic
1143426700 17:6845184-6845206 TGCTGGCAGTGAGGGTGGGGAGG - Intergenic
1143432265 17:6895658-6895680 GGCTGGCGGGGGGGGGGGGGGGG + Intronic
1143735033 17:8905625-8905647 TGCTGGAGGTGAGGGAGGAGGGG - Intronic
1144137770 17:12314688-12314710 TGGTGGTGGTGGGAGTGTGGGGG + Intergenic
1144224371 17:13130710-13130732 TGATGGGGGAGGGGGAGGGGAGG + Intergenic
1144275250 17:13660941-13660963 TGGTGGTGGAGAGGGAGTGGTGG - Intergenic
1144708474 17:17385146-17385168 TGCAGGCTGTGCAGGAGTGGAGG + Intergenic
1144762117 17:17712979-17713001 GGCTGGGGGTGGGGAAATGGGGG + Intronic
1145241625 17:21243685-21243707 TCCTGGCGGGGTGGGGGTGGAGG + Intronic
1145267978 17:21389644-21389666 TGCAGAGGGTGGGGGTGTGGTGG + Intronic
1145279384 17:21456820-21456842 TAGGGGAGGTGGGGGAGTGGGGG + Intergenic
1145770741 17:27491350-27491372 TGTTGGGGGTGGGGTAGGGGCGG + Intronic
1145911840 17:28547638-28547660 TTCTGGGAGTGGGGAAGTGGGGG - Intronic
1145989549 17:29070705-29070727 AGCTGGCCGTGTGGGACTGGAGG - Intergenic
1146159722 17:30553347-30553369 TGAGGGCGGTGGTGGAATGGGGG + Intergenic
1146401347 17:32502400-32502422 TGCGGGGAGTGGGGGCGTGGAGG + Intronic
1146638134 17:34520999-34521021 TGCTGGCAGGAGGGGAGTGGTGG - Intergenic
1147187727 17:38721938-38721960 TGCTGGAGGAGGGGCAGCGGTGG - Exonic
1147190461 17:38735340-38735362 GGCTGTCGAAGGGGGAGTGGGGG + Exonic
1147317484 17:39627709-39627731 GGCTGGGGGTGCGGGGGTGGGGG + Intronic
1147378065 17:40034852-40034874 TGCTGGGGGTGGGGGGTGGGGGG - Intronic
1147575817 17:41598529-41598551 TGGTGGTGGTGGGGCTGTGGGGG + Intergenic
1148152235 17:45403712-45403734 AGGTGGGGGTGGGGAAGTGGGGG + Intronic
1148165509 17:45481654-45481676 CACTGGGGGTGGGAGAGTGGGGG + Intronic
1148218662 17:45847701-45847723 AGCTGGGGGAGGGGGAGGGGTGG + Intergenic
1148432054 17:47650317-47650339 TGATTGGGGTGGGGGAGGGGAGG + Intronic
1148438010 17:47696994-47697016 TGCTGGGAGTGGGGGTGGGGAGG + Intronic
1148792869 17:50183477-50183499 TCCTGGCCCTGGGGGAGTGAGGG - Exonic
1148863217 17:50615278-50615300 TGGTGGCTGTGAGGGACTGGGGG + Intronic
1148864827 17:50623044-50623066 TGCTGTCAGTGGGGGAGGTGAGG - Intronic
1149993544 17:61395827-61395849 GGGCGGCGGTGGGGGAGTGGGGG - Intergenic
1150216959 17:63476552-63476574 TGCCGGGGGTAGGGGTGTGGCGG - Intergenic
1150376335 17:64684586-64684608 TGCTGGGGGTGGAGGTGGGGTGG + Intergenic
1150396736 17:64828370-64828392 CACTGGGGGTGGGAGAGTGGGGG + Intergenic
1150473589 17:65457845-65457867 TGCTGGCAGTGGGGCTGGGGCGG - Intergenic
1150486021 17:65544372-65544394 TGGTGGTGGTGGGGGATGGGGGG - Intronic
1151079335 17:71310597-71310619 TTCGGGGGGTGGGGGACTGGGGG + Intergenic
1151104511 17:71596981-71597003 GGCTGGGAGTGGGTGAGTGGAGG - Intergenic
1151199061 17:72454399-72454421 GGTTGGGGGTGAGGGAGTGGGGG - Intergenic
1151576050 17:74953118-74953140 TGGTGGCGGTGGGTGAGGGGTGG + Intronic
1151676618 17:75602045-75602067 AACTGGGGGTGGGGGAGCGGGGG + Intergenic
1151679800 17:75617227-75617249 TGGTGGAGGTGGGGGTGTGTGGG - Intergenic
1151719340 17:75846650-75846672 TGCTGGGGCTTGGGGAGGGGAGG - Exonic
1151843165 17:76632155-76632177 GGCTGGGGGTTGGGAAGTGGAGG - Intronic
1152146495 17:78571864-78571886 TGCTGGTGGTTTGGGATTGGTGG - Intronic
1152337872 17:79708256-79708278 TGATGGGGGTGGGGGAGGAGGGG - Intergenic
1152457012 17:80422408-80422430 TACCGGCGGTGGGGGAGGCGGGG - Intronic
1152623437 17:81377639-81377661 TGGTGGGGCTGGGGGAGTTGGGG + Intergenic
1152655104 17:81515620-81515642 AGCTGGAGGTGGGGCAGTGCAGG - Intronic
1152738227 17:82007794-82007816 TGCAGGCGCTGGGGCTGTGGGGG + Intronic
1152757978 17:82094979-82095001 TGGTGGGGGTGGGGGCCTGGAGG + Intronic
1152843346 17:82584460-82584482 TGCGGGGGGTGGGGGTGCGGGGG - Intronic
1152990960 18:363026-363048 AGCTGGCAGGGGGGGAATGGGGG + Intronic
1153009674 18:526737-526759 TGCTGGAGGAGGGGGCCTGGAGG - Intergenic
1153464952 18:5378849-5378871 TTTTGGCGGTGGGGGGGTGGGGG - Intergenic
1153591359 18:6676620-6676642 TGCTGCAGGTGGTGGAGTTGTGG + Intergenic
1153825831 18:8874031-8874053 AGGTGGAGGTGGGGGATTGGTGG - Intergenic
1153871944 18:9329932-9329954 TGGCGGGGGTGGGGGGGTGGGGG + Intergenic
1154215721 18:12414732-12414754 TGGTGGGGGTGGAGGGGTGGGGG - Intronic
1154296144 18:13150663-13150685 TGGTGGAGGTGGGGAAGTGGGGG - Intergenic
1154358972 18:13643338-13643360 TCCTGGCGGAGGGGAAGGGGAGG - Exonic
1155090857 18:22509481-22509503 TGCTGGGGGTGGGGGGGAGGCGG - Intergenic
1155243493 18:23885325-23885347 GGGTGGGGGTGGGGGGGTGGGGG - Intronic
1155443274 18:25884356-25884378 TGCTGGGGGCTGGGGAGGGGTGG - Intergenic
1155502771 18:26503841-26503863 AGCTGGGGGTGGGGGTGGGGTGG + Intronic
1155504610 18:26521073-26521095 TGCTGGGGGAGTGGGAGTGAAGG + Intronic
1155647056 18:28091813-28091835 TAATGGCGGTGGTGGGGTGGGGG - Intronic
1155966427 18:32039713-32039735 TAATGGGGGAGGGGGAGTGGTGG - Intronic
1156457420 18:37302589-37302611 TCCTGGAGGTGGGGAGGTGGAGG + Intronic
1156472122 18:37383934-37383956 TTGTGGCGGTGAGGGGGTGGGGG + Intronic
1156807896 18:41209054-41209076 TGGCGGCGGCGGGGGAGGGGAGG - Intergenic
1157100370 18:44723758-44723780 GGCTGGCAGTGGGGGTGGGGAGG + Intronic
1157187398 18:45552368-45552390 TGCAGGGGGTGGGGGAGAGAAGG - Intronic
1157574464 18:48734213-48734235 TGCTGGGGGTGGGGGACAGAAGG - Intronic
1157695752 18:49722219-49722241 TCATGGCGGTGGGGCAGGGGCGG - Intergenic
1157748363 18:50157103-50157125 GGCTGGGGGTGGGGAGGTGGGGG + Intronic
1157849969 18:51039492-51039514 TACGGGGGGTGGGGGGGTGGGGG - Intronic
1158063886 18:53381555-53381577 TGGTGGTGGGGGGGGGGTGGGGG - Intronic
1158468367 18:57712276-57712298 TGCTGGGGCTGGGGGAGGGGTGG - Intronic
1158470907 18:57735969-57735991 TGTTGGGGGTGGGGGTGGGGGGG - Intronic
1158620951 18:59032069-59032091 GGCTGCCGGTGTGGGAGTGCGGG - Intergenic
1159699676 18:71609327-71609349 TGCTGGGGATGGGGTGGTGGTGG - Intergenic
1160134404 18:76260301-76260323 TCCTGGGGGTGGGGGGGAGGGGG + Intergenic
1160522411 18:79515444-79515466 TGGTGGTGGTGGGCGGGTGGTGG + Intronic
1160680104 19:408493-408515 TGCCGGCGGGGTGGGGGTGGAGG + Intronic
1160769164 19:822474-822496 AGCTGGGGGAGGGGGACTGGGGG + Intergenic
1160791575 19:925959-925981 GTCTGGGGGTGGGGGAGGGGCGG + Intronic
1160797662 19:953349-953371 TGGCGCCGGTGGGGGAGGGGAGG - Intronic
1160987503 19:1845956-1845978 TGCTGCCGGTGGGGAAACGGAGG - Intronic
1161047873 19:2145962-2145984 TGCTGGTGGTGCGGGAGGCGAGG + Intronic
1161129839 19:2581321-2581343 TGATGGGGGTGGGGGGGTGGGGG + Intronic
1161153149 19:2720130-2720152 TGCTGGTGGTGGGGGGGAGGCGG + Intronic
1161169547 19:2805984-2806006 TGCGGGGGGTGGGGGACGGGTGG + Intronic
1161307688 19:3577009-3577031 AGCTGGCGCTGGAGGAGCGGAGG + Exonic
1161313815 19:3608765-3608787 TGCTGGCGGGGGGTGGGGGGCGG - Intergenic
1161380315 19:3961355-3961377 TGCTGTCAGTGGCGGGGTGGGGG - Intronic
1161395705 19:4043845-4043867 TCCTGGAGGTGGGGGGGGGGGGG - Intergenic
1161428560 19:4217628-4217650 TGCTGGCGGAGGAGGAGGCGCGG + Exonic
1161443356 19:4304836-4304858 TGGAGGCGGGGAGGGAGTGGGGG - Intronic
1161466434 19:4433206-4433228 CGCTGGGGGTGGGGGTGTGCAGG - Exonic
1161565000 19:4997057-4997079 TGCTGGCGTGGAGGGGGTGGAGG - Intronic
1161614929 19:5264860-5264882 CGTTGGCTCTGGGGGAGTGGGGG - Intronic
1161643108 19:5436489-5436511 TGGTGGGGGAGGGGGAGGGGTGG - Intergenic
1161698706 19:5783843-5783865 TGCTGGTAGTGGGGGTATGGAGG + Exonic
1161708551 19:5834212-5834234 GGCTGACGCTGGGGGAGAGGTGG + Intronic
1161826738 19:6572510-6572532 TGGGGGGGGTGGGGGAGGGGTGG + Intergenic
1162132661 19:8536665-8536687 TGCTGGAGGTGGGGGACCTGGGG + Intronic
1162237523 19:9320832-9320854 AGCCGGCGGGGGGGGGGTGGGGG + Intergenic
1162320869 19:9970066-9970088 TGGGGGCTGTGGGTGAGTGGGGG + Intronic
1162320876 19:9970100-9970122 TGGAGGCTGTGGGTGAGTGGAGG + Intronic
1162320880 19:9970117-9970139 TGGAGGCTGTGGGTGAGTGGAGG + Intronic
1162320908 19:9970203-9970225 TGGGGGCTGTGGGTGAGTGGGGG + Intronic
1162497902 19:11033807-11033829 CGCTGGCGGAGGGGCAGTGTGGG - Exonic
1162504965 19:11078232-11078254 AGATGGGGGTGGGGGCGTGGGGG - Intergenic
1162521701 19:11184420-11184442 TGGGTGCGGTGGGGGAGTGCCGG + Intronic
1163117255 19:15195997-15196019 TGCTGCCGGTGGGGGGGTCTTGG + Intronic
1163463888 19:17455239-17455261 GGATGGGGGTGGGGGGGTGGGGG - Intronic
1163479996 19:17549566-17549588 TGCTGGGGGTGGGGAGGTGGAGG + Intronic
1163774157 19:19208239-19208261 TGCTGCCAGTGGGGGAGGGGTGG - Intergenic
1163790726 19:19304792-19304814 TGCTGGGAATGGGGGAGAGGTGG + Intronic
1163828574 19:19537158-19537180 TGATGGGGGAGGGGAAGTGGGGG + Intronic
1164476445 19:28579373-28579395 GGCTGGGGTTGGGGGAGAGGGGG - Intergenic
1165075652 19:33278735-33278757 TGCAGGGGGTGGGGGAGGTGAGG - Intergenic
1165111670 19:33506054-33506076 TGTTTGCGATGGGGGTGTGGTGG - Intronic
1165329408 19:35133259-35133281 TGCTGACGATTGGGTAGTGGTGG - Intronic
1165489558 19:36115381-36115403 TCCTGGCGGTGGGGAAGGGACGG + Exonic
1165743519 19:38217378-38217400 AGCTGGGGGTGGGGGTGGGGGGG - Intronic
1165750565 19:38256667-38256689 CTCTGGCGGTGGCGGGGTGGGGG + Intronic
1165786434 19:38464618-38464640 TCCTGGGGGTGGGGGAGTGGAGG - Exonic
1165861618 19:38912087-38912109 TGCTGGGGGCGGGTGAGTGCGGG - Exonic
1165876534 19:39011684-39011706 AGATGGCGGCGGGGGAGGGGGGG + Intronic
1165889173 19:39100365-39100387 TGGTGGCGGTGGGCGAGGGCTGG + Intronic
1165983639 19:39747908-39747930 TGCGGCCTGTCGGGGAGTGGGGG + Intergenic
1166678965 19:44756211-44756233 GCCTGGGGGTGGGGGAGTGAAGG - Exonic
1166734309 19:45075522-45075544 TGGTGGCGGTGGAGGGGGGGCGG - Intronic
1166914299 19:46184414-46184436 TGTCGGGGGTGGGGGACTGGGGG - Intergenic
1166975697 19:46603945-46603967 GGCTGGGGGTGGGGGCGAGGAGG - Intronic
1167001191 19:46746497-46746519 TGGTTGCGGCGGGGGAGGGGGGG - Exonic
1167243332 19:48358595-48358617 TGCTGGCTGTGGGGGTGTTCTGG - Intronic
1167281038 19:48568687-48568709 GGCTGGTGGTGGGGGAGTCTTGG + Intronic
1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG + Exonic
1167449022 19:49556285-49556307 TGCTGGGGGAAGGGGAGGGGTGG + Intronic
1167468569 19:49663087-49663109 GGCTGGAGGCAGGGGAGTGGGGG + Intronic
1167557260 19:50203999-50204021 TGCTGGGGGCGGGGGACTGGAGG - Intronic
1167621801 19:50564882-50564904 TGCTGTGGGTTGGGGATTGGGGG - Intronic
1167684817 19:50949786-50949808 GGGTGGGGGTGGGGAAGTGGGGG - Intronic
1167721589 19:51183687-51183709 TGCAGGCTGAGAGGGAGTGGTGG - Intergenic
1168229829 19:55023382-55023404 TGTTGGAGGTGGGGGCCTGGTGG + Intronic
1168286875 19:55339681-55339703 TGACGGCGGCGGGGGCGTGGCGG + Intergenic
1168338374 19:55609783-55609805 TGGTGGTGGTGGTGGAGGGGTGG + Intronic
1168406435 19:56112880-56112902 TGCTGGAGGGGGTGGGGTGGGGG - Intronic
1168602012 19:57726077-57726099 GGGTGGGGGCGGGGGAGTGGGGG - Intronic
925041369 2:733747-733769 TGCTGGAGCTGGAGGAGAGGCGG + Intergenic
925609981 2:5694160-5694182 TGGTGGCGGTGGTAGGGTGGAGG + Exonic
925922989 2:8650490-8650512 TGCAGGGGGTGGGGAAGAGGAGG + Intergenic
926109107 2:10170796-10170818 GGCTGGGGGCGGGGGCGTGGGGG - Intronic
926117224 2:10221182-10221204 CTCTGGGGGTGGGGGGGTGGCGG + Intergenic
926179544 2:10629119-10629141 GGCTGGAGGTGGAGGGGTGGTGG - Intronic
926404487 2:12537079-12537101 TGCTGGTGGTGTGTGTGTGGGGG + Intergenic
926651879 2:15355568-15355590 TGCTGGAGGTGGGGCCTTGGGGG + Intronic
927070176 2:19520263-19520285 TGCAGGGGATGGGGGAGTTGAGG + Intergenic
927519516 2:23690465-23690487 GGCTGGCGGTGGGGCTGTCGAGG - Intronic
927722748 2:25397032-25397054 TGGGGGAGGTGGGGGTGTGGGGG - Intronic
928126594 2:28620706-28620728 TGCTGGAGGAGGGGAAGAGGAGG + Intronic
928347542 2:30515031-30515053 TGGGGGCAGTGGGGGAGCGGGGG - Intronic
928599677 2:32892002-32892024 TGCTAGGGGCTGGGGAGTGGTGG + Intergenic
928666222 2:33553056-33553078 TGCTGGGGGTGGGGGTGGGGAGG - Intronic
928903987 2:36352300-36352322 TGGGGGTGGTGGGGGGGTGGGGG - Intergenic
929558118 2:42938042-42938064 TGTTGGTGGCGTGGGAGTGGGGG - Intergenic
929584650 2:43106081-43106103 TGGTGGGGGTGTGGGAGTGAGGG - Intergenic
929604095 2:43224221-43224243 TGCTGGGGGCACGGGAGTGGGGG - Exonic
929613113 2:43286451-43286473 TGTTGGTGGTCTGGGAGTGGTGG + Intronic
929664516 2:43823279-43823301 TGCTGGTGGTGGGGGCGGGGTGG - Intronic
929722863 2:44388895-44388917 TGGTGGAGGTGGCGGGGTGGGGG + Intronic
929826764 2:45314973-45314995 TGCTGGCAGGTGGGGAGTTGTGG + Intergenic
929857725 2:45650755-45650777 AGCCGGGGATGGGGGAGTGGAGG - Intergenic
930089984 2:47525186-47525208 GCCTGGAGGTGGGGGTGTGGGGG - Intronic
930346531 2:50189361-50189383 TGCTGGGGGTTGGGGGGTAGGGG + Intronic
931363333 2:61597270-61597292 TTGTGGGGGTTGGGGAGTGGCGG - Intergenic
932024057 2:68116063-68116085 TGCATGCAATGGGGGAGTGGTGG - Intergenic
932361735 2:71114177-71114199 TGCTAGGGGTGGAGGAGTGGGGG + Intronic
932375900 2:71235638-71235660 TACTGGGGGTGGGGGTGGGGTGG + Intergenic
932411535 2:71550637-71550659 TGCTGGGGGTGGGGCTGGGGAGG + Intronic
932617900 2:73247265-73247287 TGTTGGGGGTGTGGGGGTGGAGG + Intronic
932842269 2:75094675-75094697 TGGTGGAGGTGAGGAAGTGGTGG + Intronic
932861989 2:75304013-75304035 GGCTGGCTGTGGGGTAGAGGGGG - Intergenic
932912806 2:75822229-75822251 TGCAAGTGGTGGGGGTGTGGGGG - Intergenic
933512716 2:83261741-83261763 TGCTGGGGGTGTGGTGGTGGCGG + Intergenic
933773114 2:85756040-85756062 TGCTGGGGGTTGGGGTGGGGTGG + Intronic
934067079 2:88350499-88350521 TGCAGGTGGAGAGGGAGTGGGGG + Intergenic
934104812 2:88685914-88685936 TGCTGATGGTGGGGCAGTGGTGG - Intergenic
934180241 2:89612714-89612736 CTCTGGGGGTGGGGGGGTGGGGG - Intergenic
934473158 2:94574040-94574062 CTCTGGAGGTGGGGAAGTGGGGG + Intergenic
934476680 2:94598373-94598395 TCCTGGCTGTGGGGGAGAGTTGG + Intronic
934609144 2:95721803-95721825 TTATGGTGGTGGTGGAGTGGGGG + Intergenic
935303909 2:101718561-101718583 AGGTGGGGGTGGGGGGGTGGGGG + Intronic
935563648 2:104584312-104584334 TGGTGGGGGTGGGGGGGGGGCGG + Intergenic
935592518 2:104855476-104855498 TGGTGGCGGCGGTGGGGTGGCGG + Intergenic
936542466 2:113363384-113363406 TTCTGGTGGTGGCGGAGTGGGGG + Intergenic
937204588 2:120227279-120227301 TGCTGGCAGTGGGGGGGGGCAGG - Intergenic
937218928 2:120330303-120330325 TGCTGTCGGCAGGGGTGTGGGGG + Intergenic
937261168 2:120587456-120587478 GGCTGGCGGCGGCGAAGTGGCGG - Intergenic
937303603 2:120857765-120857787 TGGTGGGGGTGGGGGTGGGGGGG - Intronic
938006486 2:127791157-127791179 TGCTGGGGGGGGGGGTGGGGTGG - Intronic
938050020 2:128160797-128160819 TGCTGTCGGTGAGAGTGTGGTGG + Intronic
938462808 2:131509038-131509060 TGGAGGAGGTGGGGGAGTAGGGG - Intergenic
938539773 2:132276189-132276211 GGCTGGGGGTGGGGGTGGGGGGG + Intergenic
938570503 2:132557979-132558001 TGGTGGTGGTGGTGGGGTGGGGG + Intronic
938619120 2:133031231-133031253 TGCTGGGGGTAGGGGAGGGATGG - Intronic
938639967 2:133267284-133267306 GGCTGGGGGTGGGGGCGTGAAGG - Intronic
939257338 2:139760480-139760502 TGCTGGTGGTAGCGGAGGGGTGG + Intergenic
939681100 2:145134063-145134085 TGGTGGCAGTGGGGGGCTGGAGG + Intergenic
939958312 2:148545255-148545277 TGGTGGGGATGGGGCAGTGGGGG + Intergenic
940145525 2:150541707-150541729 TGCTGGCTGGGGGGGGGGGGGGG + Intergenic
940272780 2:151909565-151909587 TGCTGGGGGTTGGGGAGTGAGGG - Intronic
940282342 2:152000934-152000956 TGCTGGAGGTGGGAGGCTGGAGG - Intronic
940551216 2:155159008-155159030 TACTGGGGGTGGGGGTCTGGGGG + Intergenic
940716196 2:157227331-157227353 TGTTGGCGGTGGGGGGTGGGGGG - Intergenic
941058290 2:160813989-160814011 GGGTGGGGGTGGGGGGGTGGGGG - Intergenic
941058872 2:160822283-160822305 TACTAGAGGTGGGGAAGTGGGGG - Intergenic
941129303 2:161626176-161626198 GGCTGGCAGTGGGGGTGGGGTGG + Intronic
941752099 2:169144385-169144407 TGCTGGTGGAGTGGGGGTGGGGG - Intronic
942061010 2:172228738-172228760 TGCTGCCGGTGGGAGAGGGAAGG + Intergenic
942257859 2:174124221-174124243 TTCGGGGGGTGGGGGAGTTGGGG - Intronic
942451153 2:176108479-176108501 GGCGGGGGGTGGGGAAGTGGGGG + Intronic
942484988 2:176429423-176429445 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
943011559 2:182455752-182455774 TGTTGTGGGTGGGGGAATGGGGG + Intronic
943219619 2:185088993-185089015 TGCGGGGGGTGGGGGGTTGGGGG + Intergenic
943287119 2:186016260-186016282 TGGTGGCGGTGGGGGGTGGGGGG - Intergenic
943622807 2:190168407-190168429 GGAGGGCGGTGGGGGGGTGGGGG - Intronic
943669825 2:190648964-190648986 AGCGCGGGGTGGGGGAGTGGAGG + Intronic
944651846 2:201838246-201838268 AGCTGGGGGTGGGGTGGTGGGGG + Intronic
945119819 2:206445283-206445305 TGGTGGAGGTAGGGGGGTGGGGG - Intronic
945191834 2:207196794-207196816 TGGTGGTGGTGGGGTAGGGGTGG - Intergenic
945778770 2:214140930-214140952 TGGTGGGGGGGGGGGGGTGGGGG + Intronic
945862582 2:215140553-215140575 AGCCGGGGGTGGGGGTGTGGTGG - Intergenic
946029233 2:216691932-216691954 TGGCGGGGGTGGGGGAGAGGAGG + Intronic
946304404 2:218847546-218847568 TTCTGGGGATAGGGGAGTGGGGG - Intergenic
946310201 2:218879071-218879093 GGGTGGGGGTGGGGCAGTGGGGG - Intergenic
946329678 2:219002150-219002172 TGGTGGCGGGGGCGGAGGGGAGG + Intergenic
946345956 2:219110607-219110629 TGCTGGTGGGGTGGGGGTGGAGG + Intronic
946395593 2:219442301-219442323 TGCGGGCGATCGGGGAGCGGGGG - Intronic
946410285 2:219512095-219512117 AGCTGGCTGTGGGGCAGTGGTGG + Intergenic
946434164 2:219640955-219640977 TGCAGGCGGTAAGGGGGTGGTGG + Exonic
946642092 2:221794793-221794815 TACTGGGGGTGGGGGTGTGGGGG + Intergenic
946776550 2:223148355-223148377 TGGCGGCGGCGGGGGAGGGGGGG + Intronic
947392552 2:229654108-229654130 TGGTGGGGTGGGGGGAGTGGGGG - Intronic
947584184 2:231342446-231342468 CGCTGACAGTGGGGAAGTGGAGG + Intronic
947868658 2:233419729-233419751 TGCTTGCTTTGGGGGACTGGAGG - Intronic
948077710 2:235179205-235179227 TTTTGGCAGTTGGGGAGTGGTGG + Intergenic
948296992 2:236867902-236867924 TAGTGGCGGTGGGGGAATGGGGG + Intergenic
948306314 2:236949612-236949634 TGGTGGTGGTGGGGGTGGGGCGG - Intergenic
948316565 2:237031879-237031901 TGCTGGCGGTGTGTGTGTGAGGG - Intergenic
948726001 2:239934361-239934383 GGCTGGGGGTGGGGGTGGGGAGG - Intronic
948907607 2:240987148-240987170 TGCTGGGGGTGGAGGAGCAGGGG + Intronic
948984500 2:241511904-241511926 GGCTGGAGCTGGGGGAGAGGAGG + Intergenic
948993748 2:241567943-241567965 GGCTGGCAGTGGGCGAGGGGTGG - Intronic
1168796230 20:611762-611784 TGCTGGCGGTGGGGGGATCCAGG - Intergenic
1168803831 20:661646-661668 TGCTGGAGGTGGGGAAGGGATGG + Exonic
1168892570 20:1304587-1304609 TTCTGGGGGTGGTGGGGTGGGGG + Intronic
1169291764 20:4359056-4359078 AGCAGGCGGTGGGGGTGGGGCGG + Intergenic
1169345288 20:4823778-4823800 GGCTGGGGGTGGGGAGGTGGGGG + Intergenic
1169429264 20:5522012-5522034 TGCTGGCAGAGGGGTGGTGGTGG - Intergenic
1169559868 20:6787967-6787989 AGCTGGGGGTGGGGTAGTGGGGG + Intergenic
1170307485 20:14955693-14955715 GGCTGGGGGTGGGGGAGCGCTGG - Intronic
1170433968 20:16304955-16304977 TGCTGGCCGTGGAGTGGTGGTGG + Intronic
1171035579 20:21710079-21710101 TGGTGGTGGTGGGCGGGTGGGGG + Intronic
1171174177 20:23038849-23038871 TGCAGGTGGTGGCGGGGTGGGGG + Intergenic
1171370838 20:24661175-24661197 TGCTGGGGGTGGGGGCGGGGAGG + Intronic
1171448851 20:25222498-25222520 GGCTGGCGGAGGGGGAATGTAGG + Intronic
1171460072 20:25293127-25293149 CGGGGGGGGTGGGGGAGTGGGGG + Intronic
1172077568 20:32310944-32310966 TGGTGGGGGTGGGGAAGAGGAGG + Exonic
1172846934 20:37935219-37935241 GGCTGGGGGTGGGGGGCTGGGGG - Intronic
1172959753 20:38790324-38790346 AGCTGGGGGTGGGGACGTGGAGG - Intergenic
1173016165 20:39227756-39227778 TGCTGGCTGGGGAGGAGAGGGGG + Intergenic
1173173337 20:40744714-40744736 GGGTGGCTGTGGGGAAGTGGTGG - Intergenic
1173182646 20:40816358-40816380 AGCTGGGGGTGAGGGAGTGGGGG - Intergenic
1173257926 20:41408219-41408241 AGCTGGGGGTGGGGGTGGGGAGG + Intronic
1173643812 20:44621414-44621436 GGCAGCCGGTGGGGGCGTGGGGG + Intronic
1173836005 20:46126206-46126228 TACTGGGGGTGTGGGGGTGGGGG - Intronic
1173861028 20:46283707-46283729 TGATGGCGGTGGGGGTGGGGAGG - Intronic
1174122371 20:48275928-48275950 TGCTGGCAGGAGGGGAGGGGTGG - Intergenic
1174390228 20:50214411-50214433 AGCTGGAGGTGGGGAGGTGGTGG + Intergenic
1174412256 20:50343729-50343751 TGCCGACGGTGGGAGAGGGGAGG + Intergenic
1174426282 20:50433813-50433835 TGGTGGCGGCGGGGTGGTGGCGG - Intergenic
1174491872 20:50904954-50904976 TGCAGGCAGGGGTGGAGTGGGGG - Intronic
1174511669 20:51058092-51058114 GGCTGCCTGTGGGGGAGAGGGGG - Intergenic
1175191374 20:57214296-57214318 TGCTGGGGCAGGGGGAGTGCGGG - Intronic
1175418316 20:58816083-58816105 AGCTTGAGGTGGGGGTGTGGGGG - Intergenic
1175429222 20:58890745-58890767 TGGTGGCGGTGGCGGGGTGGGGG - Intronic
1175537198 20:59722818-59722840 TGCTCACGGTGGGGGCATGGGGG + Intronic
1175734522 20:61376097-61376119 TGGTGGTGATGGTGGAGTGGTGG + Intronic
1176035401 20:63033889-63033911 GGCTGGGGGTGGGGGTGGGGTGG + Intergenic
1176088750 20:63309734-63309756 TGCTGGAGTAGCGGGAGTGGGGG - Intronic
1176103731 20:63376051-63376073 TGGTGGGGGTGTGGGGGTGGTGG - Intronic
1176857394 21:13983987-13984009 TGGTGGCGTTGGGGGAGTGGAGG + Intergenic
1176933565 21:14841972-14841994 CGCTGGCGGAGGAGCAGTGGAGG - Intergenic
1176933599 21:14842123-14842145 TGCTGGCGGAGGAGCAGTGGAGG - Intergenic
1177294237 21:19154392-19154414 TGCTGGCTGTTGGGAAGAGGAGG - Intergenic
1177312974 21:19421256-19421278 TGCTAGAGGTGGGGGTCTGGTGG + Intergenic
1177388675 21:20439195-20439217 TGCTGGGGGTGGCGGAGTCAGGG + Intergenic
1177995730 21:28094859-28094881 AGATGGGGGTGGGGGAGTGAGGG + Intergenic
1178258145 21:31074207-31074229 TGTTTGTGGTGGGGGAGTGGTGG - Intergenic
1178951983 21:36992803-36992825 TGCCAGGGGAGGGGGAGTGGAGG - Intergenic
1179031832 21:37727310-37727332 TGGTGGTGTTGGTGGAGTGGTGG + Intronic
1179038431 21:37780575-37780597 TGGTGGGGGTGGGGGAGTGCAGG + Intronic
1179161839 21:38905687-38905709 TGCGGGGGGTGGGGGTGTGCGGG - Intergenic
1179510688 21:41871339-41871361 TGCAGGAGGTTGGGGGGTGGGGG - Intronic
1179521884 21:41951080-41951102 TGATGGCGGTGTGGGAGAGCAGG - Intronic
1179722383 21:43323075-43323097 GGCTGGCGATGGGCTAGTGGAGG + Intergenic
1179833205 21:44011611-44011633 TACTGGCGGAGGGGGTGGGGCGG + Intergenic
1180105862 21:45617636-45617658 TGCTGGAGATGGGAAAGTGGAGG + Intergenic
1180230981 21:46426648-46426670 TGCTGGGGCTTGGGGTGTGGAGG - Intronic
1180611285 22:17099850-17099872 TGCTGGCCCAGGGTGAGTGGGGG + Intronic
1180791213 22:18576717-18576739 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1181093757 22:20492297-20492319 TGGTGGCCCTGGAGGAGTGGAGG - Intronic
1181113082 22:20613178-20613200 TGGAGGAGGTGGGGGAGTGGGGG + Intergenic
1181230525 22:21418597-21418619 TCCTGCTGTTGGGGGAGTGGGGG - Intronic
1181248125 22:21516272-21516294 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1181335501 22:22125207-22125229 TGCTGGCGGTGGAGTGGTTGGGG + Intergenic
1181463178 22:23097167-23097189 CCCTGGGGATGGGGGAGTGGGGG + Intronic
1181492870 22:23271642-23271664 TGCTGGCAGAGGGGGCGTTGTGG + Intronic
1181539483 22:23565829-23565851 GGCTGGAGGTGGCGGAGTTGTGG - Intergenic
1182030766 22:27157682-27157704 GGCCGGCGGTTGGGGGGTGGGGG - Intergenic
1182411335 22:30189507-30189529 TCCTGGGGGTGGGGGATGGGTGG + Intergenic
1182435360 22:30326526-30326548 TGGTGGGGGTGGGGCAGGGGAGG + Intronic
1182549639 22:31093837-31093859 TGGTGCCGGTGGAGGAGCGGCGG - Intronic
1182766069 22:32759640-32759662 GGCTGGGGGTGGGTGAGTGCTGG - Intronic
1182919634 22:34067445-34067467 TGCTGGAGGTTGGGGAGAGGTGG + Intergenic
1182950649 22:34372549-34372571 AGCTGGCGTTAGGGGTGTGGAGG - Intergenic
1183279426 22:36924111-36924133 TGAAGGCGGTGGAGGGGTGGGGG - Intronic
1183347270 22:37314798-37314820 GGCTGGCAGTGGGGCAGAGGCGG - Exonic
1183347851 22:37317851-37317873 TGTGGGCAGTGGGGTAGTGGGGG + Intergenic
1183503427 22:38194876-38194898 TGCTGGGGGTGGGGAGGGGGGGG + Intronic
1183543162 22:38441437-38441459 GGCTGGGGGTGGGGGTGAGGTGG + Intronic
1183591458 22:38781467-38781489 CGCTGGAGATGGGAGAGTGGAGG - Intronic
1183642685 22:39101693-39101715 GGCAGGGGGTGGGGGGGTGGCGG + Intronic
1183700525 22:39448512-39448534 TGCTGGGTGTGGAGGAGAGGAGG + Intergenic
1183706195 22:39476179-39476201 GACTGGAGGTGGGGGAGGGGTGG + Intronic
1183990499 22:41594349-41594371 GGGAGGCGGTGGGGGGGTGGGGG + Intergenic
1183990511 22:41594369-41594391 GGGAGGCGGTGGGGGGGTGGGGG + Intergenic
1184128936 22:42505710-42505732 TGCGTGTGGTGGGGCAGTGGGGG - Intergenic
1184137731 22:42559025-42559047 TGCGTGTGGTGGGGCAGTGGGGG - Intronic
1184561781 22:45268165-45268187 GGCTGGCGGGGAGGGAGAGGGGG - Intergenic
1184920622 22:47603277-47603299 TGTTGGAGGTGGGGGCCTGGTGG + Intergenic
1184920644 22:47603355-47603377 TGTTGGAGGTGGGGGCCTGGTGG + Intergenic
1184920666 22:47603433-47603455 TGTTGGAGGTGGGGGCCTGGTGG + Intergenic
1184920688 22:47603511-47603533 TGTTGGAGGTGGGGGCCTGGTGG + Intergenic
1184957275 22:47898158-47898180 TGGAGGTGGTGGTGGAGTGGGGG + Intergenic
1185211019 22:49570563-49570585 TGGTGGCCATGGGGGTGTGGGGG - Intronic
1185278525 22:49960279-49960301 TCCTGGGGGTGTGGGAGTGCGGG - Intergenic
949090896 3:27803-27825 TGCCGGGGGTGGGAGGGTGGTGG - Intergenic
949158212 3:851800-851822 TGGTGGTGGTGGTGGTGTGGAGG + Intergenic
949208850 3:1473853-1473875 TGGGAGCGGTGGGGGAGTGGTGG + Intergenic
949511219 3:4768771-4768793 GCCTGGGGGTGGGGGCGTGGAGG + Intronic
949946704 3:9195383-9195405 GGCTGGCAGGGTGGGAGTGGGGG - Intronic
950124957 3:10505318-10505340 TGGTGGCGGTGGCAGCGTGGAGG - Intronic
950153935 3:10708331-10708353 GGCTGGCTGTGGGGGTGGGGCGG - Intergenic
950172922 3:10851904-10851926 TGGTGGCAGTGGGGGAGGGGAGG - Intronic
950309983 3:11948749-11948771 TGATGGCGGGGTGGGGGTGGGGG + Intergenic
950432678 3:12960005-12960027 TGCTGGGGGAGGGGGAGGTGCGG - Intronic
950527029 3:13530272-13530294 AGCTGAGGCTGGGGGAGTGGAGG - Intergenic
950633163 3:14297735-14297757 CGCTGGCGTTGGGGGCATGGAGG - Intergenic
951028688 3:17858182-17858204 TGGTGGGGTTGGGGGAGGGGGGG - Intronic
951542844 3:23798569-23798591 TGCTGGGGGTTGGGGGGTGGCGG + Intergenic
951700291 3:25489642-25489664 TGCTGGTAGTGGGGGCTTGGCGG + Intronic
952155819 3:30642297-30642319 TGGTGGTGGGGTGGGAGTGGGGG + Intronic
952747221 3:36792640-36792662 GGCTGGCGGGGTGGGGGTGGTGG - Intergenic
952761048 3:36914584-36914606 AGCTGGGGATGGGGGATTGGGGG - Intronic
952784248 3:37136956-37136978 TGGGGGGGGTGGGGGGGTGGGGG + Intronic
952852596 3:37741273-37741295 TGCTGGGGGTGGGGGTGGGGTGG - Intronic
952998274 3:38906340-38906362 AGCTGGTGGTGGGGGAGGGATGG - Intronic
953388744 3:42522522-42522544 TGCAGGTGGTAGGGGAGGGGAGG - Intronic
953390307 3:42530045-42530067 TGCTCAATGTGGGGGAGTGGAGG - Intronic
953410497 3:42688089-42688111 GGCTGAGGCTGGGGGAGTGGGGG + Intronic
953798840 3:46005928-46005950 TGCTGACAGAGGGGCAGTGGTGG - Intergenic
953978306 3:47399231-47399253 TGCTGGGGGTGGGGGATGGGTGG + Intronic
954025633 3:47781451-47781473 AGCGGGCGGCGGGGGCGTGGCGG + Intronic
954143795 3:48624018-48624040 TGCTGGCAGTGGGGGTATTGAGG - Intergenic
954333248 3:49901939-49901961 TGGCGGGGGTGGGGGAGGGGAGG + Intronic
954337672 3:49929329-49929351 TGTTGGCGGGGCGGGGGTGGGGG + Intronic
954397551 3:50300944-50300966 GGGTGGGGGTGGGGGAGGGGTGG - Intronic
954405871 3:50344812-50344834 GGCTGGTGGTGGGGAAGGGGTGG - Intronic
954433458 3:50483603-50483625 TGCTGGGTTGGGGGGAGTGGAGG + Intronic
954469171 3:50676709-50676731 TGGCGGGGGTGGGGGCGTGGGGG + Intronic
954564314 3:51586010-51586032 TGGTGGCGGTGGGGGCGGGGTGG - Intronic
954592446 3:51794457-51794479 TGGTGGCGGGGGAGGGGTGGTGG - Intergenic
954715581 3:52525142-52525164 TGCTGGGGGCGGGGGGGGGGGGG + Intronic
955339693 3:58115986-58116008 TGCTGGGGGTGGGGGTGGGAAGG - Intronic
955712775 3:61797586-61797608 GGCGGGAGGTGGGGGGGTGGGGG - Intronic
956604893 3:71064620-71064642 TGGAGGCGGGGAGGGAGTGGAGG - Intronic
956959535 3:74382517-74382539 GGCTGGTGGTGGGGGAGTTGGGG - Intronic
957350355 3:79016925-79016947 AGCTAGGGGTGGGGGACTGGAGG + Intronic
957505529 3:81115851-81115873 TGCAGGAGGTGGGGGTGGGGCGG + Intergenic
957530246 3:81431522-81431544 TGTTGGGGGTGGGGGGGTAGGGG + Intergenic
958422271 3:93942207-93942229 GGCTTGCGGAGAGGGAGTGGAGG - Intronic
958513824 3:95086010-95086032 TGTGTGTGGTGGGGGAGTGGGGG + Intergenic
958585190 3:96077970-96077992 TCCTTGAGGTGGGGGAGAGGGGG + Intergenic
958617492 3:96514599-96514621 AGCTGGGGATAGGGGAGTGGTGG - Intergenic
958619065 3:96533007-96533029 TGGTGGGGGTGGGAGATTGGGGG + Intergenic
958840832 3:99202888-99202910 TGTTGTGGGTGGGGGGGTGGAGG + Intergenic
959216510 3:103456820-103456842 TGGTGGGGGTGGGGGTGTGTGGG - Intergenic
959591723 3:108089999-108090021 GGGTGGGGGTGGGGGGGTGGAGG + Intronic
960266336 3:115624893-115624915 TGGTGGGGGTGGGGGTGTGGTGG + Intronic
960872714 3:122265894-122265916 TGCTGGAAGTTGGGGAATGGGGG + Intronic
960887275 3:122409009-122409031 GGCGGGGGGTGGGGGAGCGGGGG - Intronic
960941297 3:122936776-122936798 TGTTGGAGGTGGAGGAGTGGGGG - Intronic
960952883 3:123011147-123011169 TGATGGGGGTGGGAGAGTGAGGG - Intronic
960962682 3:123083203-123083225 TGCTCGGGGTGGGGGAGGGGGGG + Intronic
961038271 3:123658717-123658739 TGCTGGAGGTGGGAGAGTAGCGG - Intronic
961175016 3:124827981-124828003 AGCTGGCGGCGGGGGCGTTGGGG - Intronic
961533156 3:127552331-127552353 GGCTGGGGGTGGTGGAGTAGGGG - Intergenic
961933102 3:130554615-130554637 TGCTGGCATTGGAGGTGTGGTGG + Intergenic
962204452 3:133423536-133423558 GGCGGGCGGTGGGGTGGTGGGGG + Intronic
962354387 3:134681176-134681198 AGCTGGGGGTCGGGGGGTGGTGG + Intronic
962688252 3:137868209-137868231 TGCTGGGGGTCAGGGAGGGGTGG - Intergenic
963084935 3:141427833-141427855 TCCTTGTGGTGGGGGAGGGGAGG + Intronic
963112970 3:141701745-141701767 GGCTGGGGCTGTGGGAGTGGGGG + Intergenic
963395756 3:144731289-144731311 TTTTGGGGGCGGGGGAGTGGGGG + Intergenic
964037890 3:152220838-152220860 TGGTGGGGGTGGGGGTTTGGGGG - Intergenic
964051239 3:152396322-152396344 GACTGGTGGTGGTGGAGTGGCGG - Intronic
964253636 3:154749792-154749814 GCCTGGGGTTGGGGGAGTGGTGG - Intergenic
964483575 3:157164750-157164772 TGTTGGGGGTGGGGGTGGGGCGG - Intergenic
965545173 3:169908492-169908514 TCCTGGCGATGGGAAAGTGGAGG - Intergenic
965600903 3:170453979-170454001 AGATGGCGGTGGGGGGGCGGGGG - Intronic
965820219 3:172677631-172677653 AGCTGTTGGTGGGGGAGGGGCGG + Intronic
966122382 3:176536880-176536902 TGCTGTTGGTGGGGGTATGGTGG + Intergenic
966552323 3:181219059-181219081 TGCTGGGGTTGGGGGAGGAGGGG + Intergenic
966734290 3:183176667-183176689 TGCTGACAGTGGGGGTGGGGTGG - Intergenic
966887238 3:184383434-184383456 TGCAGAAGGTGGGGGAGGGGTGG + Intronic
967221410 3:187250924-187250946 TTCTGGGGGTGGGAGAGTGAGGG + Intronic
967364467 3:188670098-188670120 TGTTGGGGGTTGGGGAGAGGAGG + Intronic
967592372 3:191293860-191293882 AGCCGGGGGTGGGGGAGTCGGGG + Intronic
967666733 3:192181712-192181734 TGCTTGAGCTGGGGCAGTGGAGG - Intronic
967849092 3:194069184-194069206 TGAAGGCGGTTTGGGAGTGGAGG - Intergenic
967870304 3:194224056-194224078 TGCTGGTGGTGGAGGTGTGGAGG - Intergenic
968068081 3:195770063-195770085 TGGTGGCAGTGGGGGGGTGGCGG + Intronic
968961389 4:3746016-3746038 TGCAGGGAGTGGGGGAGGGGCGG + Intergenic
969455440 4:7297406-7297428 GGGTGGGGGTGGGGGAGGGGCGG - Intronic
969468517 4:7371948-7371970 TGGGGCCGGTGGGGGAGTGAGGG + Intronic
969518540 4:7662226-7662248 GGGTGGGGGTGGGGGAGGGGGGG - Intronic
969963947 4:10975207-10975229 TCCTGGAGGTGGGGGTGTGGAGG - Intergenic
970256144 4:14172152-14172174 AGCTGGCTGAGGGGTAGTGGAGG + Intergenic
970392630 4:15631061-15631083 TGGTGGGGGTAGGGGACTGGGGG - Intronic
971006978 4:22386035-22386057 TGCTGGCGGTGGGGAAGGACTGG - Intronic
971081796 4:23221312-23221334 TGCGGGGGGGGGGGGGGTGGGGG - Intergenic
971173813 4:24261807-24261829 TGTTGGAGGTGGGGAGGTGGAGG - Intergenic
971480427 4:27109702-27109724 TGCTTGGGGTGGGGGTGCGGAGG + Intergenic
972026320 4:34382565-34382587 GGGTGGGGGTGGGGGAGGGGCGG + Intergenic
972253318 4:37328390-37328412 TGCTGGGGGTGGGGGGCTAGGGG - Intronic
972344711 4:38182955-38182977 GGCTGGCGCTGCGGGACTGGCGG + Intergenic
972349827 4:38226280-38226302 GGCTGGAGGTGGGAGAGTAGTGG - Intergenic
973708536 4:53603179-53603201 TGCTGGCCGTGGGGCCATGGAGG + Intronic
973716038 4:53677217-53677239 TGTTGGAGGTGGGGGCCTGGTGG + Intronic
974942823 4:68489487-68489509 TGCTGGTGGTGGGGCAGTGATGG + Intronic
975107938 4:70590486-70590508 TGCTGGAGGAGGAGGAGTGCTGG - Intergenic
975140037 4:70909247-70909269 TGCTGGCTTTGGGGGCTTGGGGG - Intronic
975664807 4:76725141-76725163 TTTTGGCGGTGGGGGTGGGGAGG - Intronic
975868314 4:78749388-78749410 TGGTGGTGGTGGGGGAAGGGTGG - Intergenic
976177673 4:82371930-82371952 TGCTGGTTTTGGGGGAGTGGTGG - Intronic
976184175 4:82429209-82429231 CGCTGGGGGAGGGGGAGCGGGGG + Intronic
976287750 4:83386426-83386448 CTCTGGCGGTGGGGGTGGGGTGG - Intergenic
976549135 4:86374252-86374274 TGTTGGGGGTGGGGGACTAGGGG + Intronic
977471767 4:97452123-97452145 TGCTGGGGGCGGGGGGGGGGGGG - Intronic
977513806 4:97995165-97995187 TGCAGGGGGTGGGGGGGTGAGGG - Intronic
977564527 4:98567793-98567815 TGTTGGCGGTGGTGGCGGGGCGG + Intronic
977573388 4:98653251-98653273 TTGGGGCGGTGGGGGAGGGGGGG - Intronic
978133306 4:105226464-105226486 TGTTGGAGGTGGGGGCCTGGTGG + Intronic
978285587 4:107073430-107073452 TGGTGGGGGTGGGGGGGAGGGGG - Intronic
978389796 4:108213549-108213571 TGGTGGCAGTGGGGGATGGGAGG + Intergenic
978471900 4:109077428-109077450 TGTTGGGGGCGGGGGGGTGGTGG - Intronic
978620073 4:110628998-110629020 CGCGGGGGGTGGGGGAGGGGAGG + Intronic
978797279 4:112720983-112721005 TGCTGGTGGGGATGGAGTGGAGG - Intergenic
979267532 4:118720719-118720741 TGTTGGGGGTGGGGGAATTGGGG - Intergenic
979868153 4:125781693-125781715 TGTTGGGGGTTGGGGGGTGGGGG + Intergenic
980350722 4:131680528-131680550 AGTTTGCTGTGGGGGAGTGGTGG + Intergenic
981258413 4:142690841-142690863 TTCTGGAGGTGGGGGTGAGGAGG - Intronic
981558727 4:146023879-146023901 TGCTGGGGCTGGGGGAGGAGAGG + Intergenic
981937480 4:150251526-150251548 TGTGGGGGGTGGGGGTGTGGGGG - Intronic
982199148 4:152943224-152943246 TGGTGGGGGTGGAGGAGGGGAGG - Exonic
982221708 4:153130210-153130232 TGCTGGTGGTGGTGGTGGGGTGG - Intergenic
982368705 4:154609197-154609219 TGATGGTGGTGGGGTGGTGGGGG + Intronic
982532589 4:156564847-156564869 TGCTCGTGGTGGGGGCGGGGGGG - Intergenic
982655076 4:158137720-158137742 TGCTGGCGGGGGTGGAGCAGGGG - Intronic
983254220 4:165379592-165379614 TGGTGGCGGTGGGGGAAGGAGGG + Intronic
984102165 4:175499536-175499558 TGGTGGGGTTGGGGGAGGGGAGG - Intergenic
984377588 4:178953303-178953325 TGATGGGGGTGGTGGCGTGGTGG - Intergenic
984567004 4:181343132-181343154 TGGTGGGGGTGGGGGGGTGCGGG - Intergenic
984615583 4:181893489-181893511 TGGTGGGGGTGGGGGGGGGGTGG - Intergenic
984760313 4:183357517-183357539 TGCTGGCCGTCGGGGTCTGGAGG + Intergenic
985129651 4:186726722-186726744 TGGAGGCGGTGGGGGAGGGGAGG + Intronic
985143148 4:186863708-186863730 AGCTGGTGGTGGAGGAGAGGTGG - Intergenic
985451987 4:190067646-190067668 TGGTGGTGGTGGGGGGGGGGGGG - Intergenic
985561152 5:586690-586712 AGGTGGCAGTGGGGGAATGGGGG + Intergenic
985870796 5:2554836-2554858 TGCTGGAGATGGGGCAGTGATGG - Intergenic
985894869 5:2743084-2743106 TTCTGGAGTTGGGAGAGTGGTGG - Intergenic
986177268 5:5363243-5363265 AGGTGGCGGGGGGTGAGTGGCGG + Intergenic
986496107 5:8343772-8343794 TGCTGTGGGTGGGGGCCTGGTGG - Intergenic
986518473 5:8588017-8588039 TACTGGAGGTGAAGGAGTGGAGG + Intergenic
987175165 5:15300384-15300406 GGCTGGCGGTGGAGTAGTGCCGG - Intergenic
987263737 5:16229571-16229593 TCCTAGCCCTGGGGGAGTGGGGG + Intergenic
987279178 5:16395144-16395166 TGTTGGGGGTGGGGGGCTGGGGG - Intergenic
988554429 5:32224011-32224033 TGGTGGGGGTGGGGCAGGGGTGG - Intergenic
989103459 5:37840136-37840158 GCCTGGCGGTGGGGGAGGAGAGG + Intergenic
989138774 5:38181667-38181689 TGTTGGGGGTGGGGGGCTGGGGG + Intergenic
989750285 5:44884294-44884316 TGCTTGCGGGGGAGGTGTGGAGG - Intergenic
989780806 5:45262541-45262563 TGCTGGGACTGGGGGAGTGCAGG + Exonic
990486955 5:56268695-56268717 TGCGGGGGGTGGGGGACTAGGGG - Intergenic
991511615 5:67383840-67383862 TGCTGGCTATAGGGCAGTGGTGG - Intergenic
991596324 5:68310333-68310355 TGCTGGGGGTGGGGGGATGGGGG + Intergenic
991645170 5:68794322-68794344 TCCTGGCTGTGGGGGAGTGAGGG - Intergenic
992379565 5:76223908-76223930 TGGTGGGGATGGGGAAGTGGTGG + Intronic
993677259 5:90831709-90831731 TGGTGGCGGTGGGGCAGAGGGGG - Intronic
993892495 5:93490832-93490854 TGGTGGTGGTGGTGCAGTGGTGG + Intergenic
993892606 5:93491359-93491381 TGGTGATGGTGGGGGGGTGGTGG + Intergenic
994206196 5:97038667-97038689 TGTTGGCGGTGGGGGGTCGGGGG - Intergenic
994327392 5:98464158-98464180 TGGTGGGGGTGGGGAATTGGTGG + Intergenic
994978119 5:106837858-106837880 TGTTGGGGGTGGGGGACTAGGGG - Intergenic
995292534 5:110473969-110473991 GGCTGGGGGTGGGGGAGAGTAGG + Intronic
995606439 5:113860541-113860563 TTCTGGGGTTGGGGGAGAGGAGG + Intergenic
995912534 5:117204624-117204646 GGCTGGCGAAGGGGGAGGGGGGG + Intergenic
996089364 5:119335875-119335897 TGCAGGGGGTGAGGGGGTGGAGG + Intronic
996404007 5:123089485-123089507 TGCTGCCGGTGGGTGCGTGCGGG - Exonic
996582002 5:125041504-125041526 TGCTGGGGGCGGGGGCGGGGTGG - Intergenic
997266367 5:132497253-132497275 TGCTGAGGGTGGGGGTGTGAAGG + Intergenic
997284137 5:132666361-132666383 TGGTGGTGGTGGGGAAGGGGCGG - Intergenic
997521028 5:134524871-134524893 TGCTGGCAGGAGGGGAGTGGAGG - Intronic
997670985 5:135671852-135671874 GGGTGGGGGTGGGGGAGTAGAGG - Intergenic
997721081 5:136078996-136079018 TGTTGGTGGTGGCGGAGTGAGGG - Intergenic
998400741 5:141847671-141847693 AACTGGAGGTGGGGGAGGGGAGG - Intergenic
998462519 5:142320327-142320349 TGCTGGGGGTAGGGAGGTGGGGG - Intronic
998632822 5:143919091-143919113 TGGAGGTGGTGGGGGAGTGGGGG + Intergenic
998666847 5:144307410-144307432 TGCTGAGGGTGGGGGTATGGAGG - Intronic
998719446 5:144927666-144927688 TGGGGGCGGTGGGGGATGGGGGG - Intergenic
999240537 5:150124902-150124924 GGCCGGGGGTAGGGGAGTGGGGG - Intronic
999370264 5:151050848-151050870 TGTTGGGGCTGGGGGAGGGGTGG + Intronic
999406736 5:151313118-151313140 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
999722999 5:154412622-154412644 GGTTGGTGGTGGGGGAGTGGAGG - Intronic
1000003452 5:157162196-157162218 TGCTGGCCGTGGGCGGGTGGTGG + Exonic
1000159983 5:158587620-158587642 TGCTGGGGGTTGGGGAGGGGTGG + Intergenic
1000233265 5:159335033-159335055 TGGTGGTGGGCGGGGAGTGGCGG - Intergenic
1001398883 5:171435132-171435154 GGCTGGTGGGGAGGGAGTGGTGG + Intronic
1001419820 5:171578119-171578141 AGCTGGGGGTGGGTGAGTGAAGG + Intergenic
1001437912 5:171714960-171714982 GGCTGGGGGTGGGAGAGTGCTGG - Intergenic
1001503783 5:172260067-172260089 TGTTGGGGGTGGGGGTGCGGCGG - Intronic
1001672792 5:173488073-173488095 AGGTGGCGGCGGGGGAGTGGTGG + Intergenic
1001712319 5:173788816-173788838 TGCTGGGGGTAGGGGGGTTGAGG + Intergenic
1001824880 5:174736421-174736443 TGCTGGGGGAGGGGGAGTGGAGG - Intergenic
1002049116 5:176559761-176559783 TGATGGGGGAGGGAGAGTGGTGG - Intronic
1002167655 5:177358320-177358342 TGCAGCAGGTGAGGGAGTGGTGG - Intronic
1002348433 5:178564301-178564323 GCCTGGAGGTGGGGGAGAGGTGG - Intronic
1002381444 5:178832333-178832355 TGCTGGCGGTGGGTGGTGGGAGG - Intergenic
1002381457 5:178832379-178832401 TGCCTGCCGTGGGGGACTGGTGG - Intergenic
1002428101 5:179187587-179187609 TGCTGGGGGGAGGGGAGGGGAGG - Intronic
1002569015 5:180129531-180129553 TGCTGGCTGTGAGGGTCTGGGGG - Intronic
1002617481 5:180464636-180464658 TGGGGGAGGTTGGGGAGTGGGGG - Intergenic
1002638324 5:180618974-180618996 CGCGGGCGGCGGGGGAATGGAGG - Intronic
1002779282 6:354003-354025 TGCAGATGGTGGGGGAGTGGAGG + Intergenic
1002968151 6:1988457-1988479 TCTTGGCGGTGGGGGCGAGGGGG + Intronic
1003145243 6:3504859-3504881 TGCTGGCTGGGGGGGAGGTGGGG + Intergenic
1004111979 6:12727628-12727650 GGCTGGCGCTGGGTGAGTGTGGG - Intronic
1004176387 6:13343843-13343865 TGTTGGAGGTGGGGGCCTGGTGG + Intergenic
1004483261 6:16040698-16040720 TGCTTGCGGGGGAGGTGTGGAGG - Intergenic
1004497663 6:16180340-16180362 TGCGGGCGGGGGTGGGGTGGTGG - Intergenic
1004932628 6:20476678-20476700 TGTTCGCGGTGGGGGCGGGGAGG + Intronic
1005544068 6:26845213-26845235 TGTTGGGGGTGGGGGCCTGGGGG + Intergenic
1005762563 6:28980796-28980818 TGCTAGAGGTGGGGGAGGGGAGG - Intergenic
1006042719 6:31269465-31269487 TGATGGCGGCGGGCGTGTGGAGG - Intronic
1006052322 6:31354605-31354627 TGGTGGGGGTGGGAGTGTGGAGG - Intronic
1006170115 6:32087602-32087624 GGCTGGCGGTGGGGCGGGGGTGG + Intronic
1006188025 6:32191496-32191518 CGCTGGCACTGGAGGAGTGGAGG + Exonic
1006434805 6:34020526-34020548 AGTTGGGGGTGGGGGGGTGGGGG - Intronic
1006445409 6:34077017-34077039 AGCTGGAGCTGGGGGAGGGGTGG + Intronic
1006463572 6:34177773-34177795 TCCTGGCGGTGGGGGGGTCGGGG - Intergenic
1006729425 6:36225246-36225268 GCCTGGGGGTGGGGGAGGGGAGG - Exonic
1006806743 6:36793889-36793911 GGCTGGAGGTGGGGGTGTGCAGG - Intronic
1007112776 6:39322571-39322593 GGCTGGCTATGGGGGAGAGGTGG + Intronic
1007229919 6:40341021-40341043 TGCTGGTGGTGGTGGTGGGGCGG + Intergenic
1007404334 6:41625192-41625214 TGATGGGGCTGGGGGAGGGGAGG - Intergenic
1007745930 6:44042902-44042924 CGCTGGGGCTGGGGGAGTGCAGG - Intergenic
1007785199 6:44275892-44275914 GGCAGGCGGTGGGTGAGCGGGGG - Exonic
1007969875 6:46040566-46040588 TGCTGATGGTGGGGTGGTGGTGG + Intronic
1008177741 6:48288975-48288997 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
1008661288 6:53670851-53670873 CACTGGCAGTGGGGCAGTGGTGG + Intergenic
1008857761 6:56112501-56112523 TGCTGGGGAAGGGGGAGGGGTGG - Intronic
1009936674 6:70242297-70242319 TGCAGGCAGTGCGGGGGTGGCGG - Intronic
1010001592 6:70955418-70955440 GGGTGGCGGTGGAGGGGTGGGGG - Intronic
1010101870 6:72119797-72119819 TTGTGGGGTTGGGGGAGTGGGGG - Intronic
1010134918 6:72540421-72540443 TTGTGGGGGTGGGGGGGTGGGGG - Intergenic
1011075234 6:83431254-83431276 TGGTGGCGGAGCGGGGGTGGCGG + Intergenic
1011260608 6:85466162-85466184 TGGGGGCTGGGGGGGAGTGGAGG - Intronic
1011574073 6:88775386-88775408 TGCTGAGGATGGGGGAGTTGGGG - Intronic
1011640225 6:89411500-89411522 GTCTGGCGGTTGGGGAGGGGAGG - Intronic
1011664728 6:89622998-89623020 GGGTTGGGGTGGGGGAGTGGGGG + Intronic
1011849033 6:91603120-91603142 TGTTGGAGGTGGGGCATTGGGGG - Intergenic
1012527108 6:100191192-100191214 TGCTGGCAATGGGGGAGTGACGG - Intergenic
1012797487 6:103780954-103780976 TGCTAGGGGTGGGGTGGTGGGGG + Intergenic
1013177694 6:107691305-107691327 TGCTGTCGGTGGAGGCGGGGAGG - Intergenic
1013765061 6:113564907-113564929 TGGAGGGGGTGGGGGAGTGTTGG - Intergenic
1013814662 6:114083423-114083445 GGATGGGAGTGGGGGAGTGGGGG + Intronic
1013821180 6:114154975-114154997 AGCTGGGGGTGGGGTGGTGGAGG - Intronic
1014043998 6:116862509-116862531 TGCTGGAGGTGGGGGCCTGATGG + Intergenic
1015162618 6:130170193-130170215 TGTTGGCGGTGGGGGACAAGGGG - Intronic
1015231869 6:130923974-130923996 GGCTGGGGGAGGGGGAGTTGAGG - Intronic
1015390719 6:132678458-132678480 TGCTGGAGGTGGGGGTCTGGTGG - Intergenic
1015683669 6:135835168-135835190 GGCGGGGGGCGGGGGAGTGGTGG + Intergenic
1016202973 6:141435028-141435050 TGTTGGGGGATGGGGAGTGGGGG + Intergenic
1016813548 6:148283250-148283272 TGGGGGAGGTGGGGGAGAGGAGG - Intronic
1016923420 6:149317761-149317783 TCCTGGCTGAGGGGGAGGGGAGG - Intronic
1017087779 6:150730330-150730352 TGGTGGGGGTGTGGGGGTGGGGG + Intronic
1017310134 6:152966504-152966526 TGTTGGGGCTGGGGGACTGGGGG - Intergenic
1017326066 6:153142660-153142682 TGCTGGTGATGGGGGAATTGTGG - Intergenic
1017622557 6:156314306-156314328 TGCTGGAGAAGGGGAAGTGGAGG + Intergenic
1017651705 6:156589339-156589361 GGGTGGGGGTGGGGGGGTGGGGG - Intergenic
1017788292 6:157774222-157774244 TGGAGGAGGTGGAGGAGTGGAGG + Intronic
1017788299 6:157774239-157774261 TGGAGGAGGTGGGGGAGTGGAGG + Intronic
1017788305 6:157774256-157774278 TGGAGGAGGTGGGGTAGTGGAGG + Intronic
1017924865 6:158901891-158901913 TGCCGGGGGTGGGAGAGGGGTGG + Intronic
1018031341 6:159844455-159844477 TGCTGGGGTTTGGGGGGTGGGGG + Intergenic
1018132964 6:160749887-160749909 TGGTGGCAGTGGTGGAATGGTGG - Intronic
1018240310 6:161767757-161767779 GGCTGGGGGTGGGGGGCTGGGGG + Intronic
1018400125 6:163413962-163413984 AGCGCGCGGTGGGGGAGGGGAGG - Intergenic
1018672973 6:166194902-166194924 TGATGTAGGTGGGGGAGGGGAGG - Intergenic
1018706870 6:166469882-166469904 TGCTGGCATTGACGGAGTGGAGG - Exonic
1018803935 6:167244197-167244219 TGCTGACGGAGGAGGAGTGCTGG + Intergenic
1018829604 6:167433131-167433153 TGGTGGTGGTGGTAGAGTGGGGG + Intergenic
1018861287 6:167712530-167712552 TGCTGGGGGTGGGTGAGGCGGGG - Intergenic
1019073040 6:169365620-169365642 TGTGGGGGGTGGGGTAGTGGGGG + Intergenic
1019379067 7:712049-712071 AGCTGGCGGTGGTGGGGGGGTGG + Intronic
1019383772 7:741825-741847 TGCTGGTGGTTGGGGGGTGTTGG + Intronic
1019470734 7:1219158-1219180 AGCTGGGTGTGGGGGAGTAGGGG + Intergenic
1019514812 7:1434983-1435005 AGCTGGGGGTGGGGGGGGGGCGG - Intronic
1019703816 7:2488078-2488100 GGCTGGGGGCGGGGGAGAGGGGG - Intergenic
1019751228 7:2731264-2731286 CGATGGCGGTGGTGAAGTGGTGG + Exonic
1019779379 7:2930503-2930525 TCCTGGCGGGGAGGGGGTGGTGG + Intronic
1020278729 7:6639164-6639186 TGCTGGGGGTAGGGGGTTGGGGG - Intronic
1021123668 7:16825955-16825977 TGCTGGGGTTGGGGGAGAGGTGG - Intronic
1021307719 7:19051723-19051745 GTCTTGGGGTGGGGGAGTGGCGG + Intronic
1021346815 7:19539269-19539291 TGCTGGAGGTGGGGATCTGGTGG + Intergenic
1021537671 7:21723741-21723763 AGCTGGGGGTGGAGGGGTGGGGG - Intronic
1021576732 7:22112095-22112117 TGCTGGGGGTGGGGGATGGAGGG - Intergenic
1021589796 7:22248560-22248582 TGCTGACAGTGGAGGAGTTGGGG - Intronic
1022231004 7:28411552-28411574 TGTGGGGGGTGGGGGGGTGGGGG + Intronic
1022339693 7:29456610-29456632 TGGTGGTGGTGGGGGGGAGGGGG - Intronic
1022539999 7:31126512-31126534 TGGTGGGGTTGGGGGAGTGGGGG - Intergenic
1022772225 7:33486031-33486053 TGTTGGCGGTGTGGGAGTAGGGG + Intronic
1022988814 7:35686805-35686827 GGCTGGGGGGGGGGGGGTGGGGG + Intronic
1023851308 7:44151899-44151921 TGCTGGTGGAGGGTGAGGGGTGG + Intronic
1024526989 7:50357343-50357365 ACTTGGCGGTGGGGGGGTGGTGG - Intronic
1024541182 7:50476274-50476296 TGGTGGCAGTGGGAGAGTGAGGG - Intronic
1024644962 7:51363277-51363299 TGCAGTGGCTGGGGGAGTGGTGG + Intergenic
1025020789 7:55477529-55477551 TGCTGCAGGTGAGGGAGGGGCGG + Intronic
1026385197 7:69839868-69839890 TGGTGGAGGTGGAGGAGAGGGGG + Intronic
1026740497 7:72975840-72975862 TGCAGGGGGTGGGGGAATTGGGG + Intergenic
1027054378 7:75039925-75039947 TGCTGGGGTTGGGGGAGGGGCGG + Intronic
1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG + Intergenic
1028086858 7:86645989-86646011 GGGTGGGGGTGGGGGGGTGGGGG + Intronic
1028370376 7:90085598-90085620 TGGTGGCGGTGGGGGTTAGGAGG - Intergenic
1028641830 7:93050877-93050899 TGCTTGAGCTGGGGGAGTGGAGG + Intergenic
1028744372 7:94310518-94310540 TGCAGGGGGTCGGGGGGTGGCGG - Intergenic
1028986456 7:97012899-97012921 AGCTGGGGGTGGGGTAGAGGAGG + Intergenic
1029110627 7:98211555-98211577 ACCTGGCGGTGGGGTTGTGGGGG + Intronic
1029133894 7:98354847-98354869 TGGTGCCGGAGGGCGAGTGGAGG - Intronic
1029205829 7:98869133-98869155 TTCTGGCGGTGGGGAAGTGGGGG + Intronic
1029253355 7:99252355-99252377 GGCTGGCGGGGGGTGAGGGGAGG + Intergenic
1029493670 7:100885624-100885646 TGAGGGCAGTGGGGGATTGGAGG + Intronic
1029669538 7:102019663-102019685 GGCTGGCTTTGGGGGACTGGTGG - Intronic
1029802037 7:102958381-102958403 TGTTGGGGGTGGTGGACTGGGGG + Intronic
1030651032 7:112116170-112116192 TGCTGGGGGCTGGGGAGAGGAGG - Intronic
1030911921 7:115261372-115261394 TGGTGGGGTGGGGGGAGTGGGGG - Intergenic
1031129056 7:117810111-117810133 TGGTGGGGGAGGGGGAGAGGAGG + Intronic
1031412403 7:121456210-121456232 TCCTGGAGTTGGGGGAGGGGTGG + Intergenic
1031427292 7:121621191-121621213 TGGTGGGGGTTGGGGGGTGGCGG + Intergenic
1031640893 7:124162150-124162172 TGCTGGGGGTGGGATGGTGGTGG - Intergenic
1031898269 7:127379839-127379861 TGGGGGGGGTGGGGGGGTGGGGG - Intronic
1032354102 7:131193741-131193763 TGGTGGGGGTTGGGGAGTTGAGG - Intronic
1032371361 7:131356513-131356535 TGCTGACAGAGGGGCAGTGGTGG + Intronic
1032391264 7:131556684-131556706 TCCTGGGGGAGGGGGAGGGGCGG - Intronic
1032803632 7:135335753-135335775 TGTTGGAGGAGGGGGAGGGGCGG + Intergenic
1033001038 7:137505121-137505143 TTCTGGGGGTGGGGGGATGGGGG + Intronic
1033322457 7:140352228-140352250 AGGTGGGGGTGGGGGAGAGGTGG + Intronic
1033747440 7:144332252-144332274 TGTTGGCGGGGGGGGTGTGGTGG + Intergenic
1033896279 7:146074263-146074285 TCCAGAAGGTGGGGGAGTGGGGG - Intergenic
1034449499 7:151129694-151129716 TGCCCGCGGTGGGGAGGTGGGGG - Intronic
1034811657 7:154137641-154137663 TGGGGGGGGTGGGGGGGTGGGGG + Intronic
1035062540 7:156079970-156079992 TGCTGGGGGTGGGGTTGGGGTGG - Intergenic
1035084675 7:156247769-156247791 TGCTGGAGGTGGGGAAGGGGTGG + Intergenic
1035112828 7:156497629-156497651 TGGTGGCGGGGGGGTGGTGGGGG - Intergenic
1035265838 7:157690025-157690047 TGCTGGGGGTGGGGGGGTGCAGG - Intronic
1035550430 8:519570-519592 GGCTGAGGGTGGGGGAGAGGGGG - Intronic
1035727404 8:1833578-1833600 TCCTGGGGGTGGGGGCTTGGAGG - Intronic
1035827810 8:2663305-2663327 TGTTGGCGGTGGGGGACAAGGGG - Intergenic
1035979071 8:4348606-4348628 TGTTGGGGGTGGGGGAGGGAGGG + Intronic
1036054786 8:5239386-5239408 TACTGGAGGTGGTGGAGTGGTGG - Intergenic
1036184496 8:6612321-6612343 GGCTGGCTGTGGAGGAGAGGAGG - Intronic
1036638051 8:10564940-10564962 TGATGCCGGTGGGGCGGTGGCGG + Intergenic
1036967744 8:13319463-13319485 TGCTGGCGGGGCGGGGGGGGGGG + Intronic
1037101476 8:15052453-15052475 TCCTGGCTATGGGGGAGTAGAGG + Intronic
1037288764 8:17328564-17328586 TGGCGGGGGTGGGGGAGTGGAGG + Intronic
1037936290 8:22917113-22917135 TGCTGGGGGCGGGGGAGGGGGGG + Intronic
1037966171 8:23135440-23135462 GCCTGGCGGTGGGGGTGTGGGGG - Intergenic
1038522384 8:28244377-28244399 TCCTGGGGGTGGGGGTGGGGCGG - Intergenic
1039404845 8:37303705-37303727 TGCTGCTGGTGTAGGAGTGGGGG - Intergenic
1039419024 8:37420273-37420295 TGCTGGAGGGGAGGGAGTGGTGG - Intergenic
1039552097 8:38450701-38450723 TGCTGCCAGTGGGGGAAGGGAGG - Intronic
1039554478 8:38466893-38466915 TGGTGGTGGTGGGGGGGGGGTGG - Intronic
1039772997 8:40707217-40707239 AGATGGGGGTGGGGGGGTGGGGG - Intronic
1040661577 8:49582255-49582277 TGGTGGGGGTGGGGGGGCGGTGG - Intergenic
1040665898 8:49632694-49632716 TGCTGGAGGTGGGGAGGTGGGGG + Intergenic
1040674551 8:49733339-49733361 TCCTAGCAGTGGGGGTGTGGAGG - Intergenic
1041101304 8:54398828-54398850 TTTTGGCGGCGGGGGAGTGGGGG - Intergenic
1041392396 8:57358657-57358679 TGTTGGAGGAGGGGGCGTGGTGG + Intergenic
1041744898 8:61197938-61197960 TGCTGGGGATAGGGGAGGGGTGG + Intronic
1041872553 8:62651694-62651716 TGTTGGAGGTGGGGGTCTGGTGG + Intronic
1042224421 8:66504399-66504421 TTCTGGGGGTGGGGGGGCGGTGG - Intronic
1042307043 8:67343386-67343408 GGGTGGAGGTGGGGGATTGGAGG + Exonic
1042837877 8:73093409-73093431 TGCTGGCGGGGCGGGGGTCGGGG + Intronic
1042885753 8:73548382-73548404 TGGTGGAAGTGGGGGGGTGGTGG - Intronic
1043161505 8:76853040-76853062 TGGTGGTGGTGGGGGAGGAGTGG - Exonic
1043247668 8:78025954-78025976 TGGTGATGGTGGGGGAGCGGGGG + Intergenic
1043577548 8:81675243-81675265 TGGCGGGGGTGGGGGGGTGGTGG - Intronic
1043724419 8:83591214-83591236 TGCTGGGAGTGGGGGAGAAGTGG + Intergenic
1043874276 8:85466339-85466361 TGGTGGTGGTGTGGGAGTGAGGG + Intronic
1044001280 8:86884211-86884233 TGGGGGCAGTGGGGGAGTGGTGG - Intronic
1044271782 8:90253241-90253263 TGCAGGAGGTTGGGGGGTGGGGG - Intergenic
1044553764 8:93539893-93539915 TGCTGGTGGTGGGGGAGGGGGGG + Intergenic
1044985337 8:97751985-97752007 TGCTTGAGCTGGGGAAGTGGAGG - Intergenic
1045063302 8:98426399-98426421 TGCTGGCTGTGCGGGACTGCAGG - Intronic
1045075024 8:98555882-98555904 TGATGGGGGTGGGGGATTAGTGG + Intronic
1045287576 8:100805254-100805276 GGCAGGGGGTGGGGGAGTGGTGG - Intergenic
1045388178 8:101690614-101690636 TTCTGGCGGGGAGGGAGTTGTGG - Intronic
1045633203 8:104151565-104151587 TTCTGGAGTTGGGGGAGTGCAGG - Intronic
1046495936 8:115012844-115012866 TGCTGCGGCTGGGGGAATGGAGG + Intergenic
1047219877 8:122910732-122910754 TGCTGGGGGGTGGGGGGTGGGGG + Intronic
1047285810 8:123486324-123486346 GGCAGGCGGTGGAGGAGAGGAGG + Intergenic
1047588116 8:126296805-126296827 GGCTGGGAATGGGGGAGTGGTGG - Intergenic
1047594701 8:126366497-126366519 GGGTGGCGGGGCGGGAGTGGCGG - Intergenic
1047797573 8:128273580-128273602 TGTTGGTGGTTGAGGAGTGGGGG + Intergenic
1047958912 8:129996716-129996738 TGCGGGCTGTGGGGGAGGGAGGG - Intronic
1048190225 8:132281703-132281725 TGGTGGTGGTTGGGGTGTGGGGG - Intronic
1048300355 8:133246731-133246753 TGGTGACGGTGGCAGAGTGGCGG - Intronic
1048860721 8:138722844-138722866 TGGGGGCGGGGGGGGGGTGGTGG + Intronic
1048881676 8:138877105-138877127 GGCTGGGGGTGGGGGAGGGGAGG - Intronic
1048998670 8:139810277-139810299 TGCTGGAGGTGGGGAGGTGAGGG + Intronic
1049194479 8:141307998-141308020 TGCGGGAGGTGGGGGTGGGGAGG + Intronic
1049292655 8:141812829-141812851 TGCTGGGGGTCAGGGAGTGAGGG - Intergenic
1049292737 8:141813058-141813080 TGCTGGGGGTCAGGGAGTGAGGG - Intergenic
1049417370 8:142501391-142501413 TGATGGAGGTGGGGTGGTGGTGG + Intronic
1049417414 8:142501578-142501600 TGATGGCGATGGTGGGGTGGTGG + Intronic
1049417466 8:142501797-142501819 TGATGGAGGTGGGGTGGTGGTGG + Intronic
1049417496 8:142501921-142501943 TGATGGCGATGGCGGGGTGGTGG + Intronic
1049423360 8:142526504-142526526 TGGTGGGGGTGTGGGGGTGGGGG - Intronic
1049611908 8:143559717-143559739 TGGTGGGGGCGGGGGAGAGGCGG + Intronic
1049734701 8:144198878-144198900 TCCTTACGGTGGGGGAGAGGAGG - Intronic
1050073580 9:1841138-1841160 TGCTGGGGTTGGGGGAGGGGCGG + Intergenic
1050151622 9:2623002-2623024 TGAACGCGGAGGGGGAGTGGAGG + Intronic
1050161466 9:2724021-2724043 TGCCGGGGGTTGGGGGGTGGAGG + Intronic
1050829520 9:9992795-9992817 TGCTGGGGGATGGGGAGAGGGGG + Intronic
1051345588 9:16148033-16148055 TGCTGGGGGCTGGGGAGGGGTGG - Intergenic
1051370216 9:16352894-16352916 GGCTGGCAGTGGGAGAGTGTGGG - Intergenic
1051372508 9:16370572-16370594 TGGAGGCGGTGAGGGGGTGGGGG - Intergenic
1051484824 9:17596882-17596904 TGCTGACGGTGGTGGATTGCTGG + Intronic
1051724826 9:20078313-20078335 GGTTGGGGGTTGGGGAGTGGGGG - Intergenic
1051849709 9:21492212-21492234 TTCTGGGGGTCGGGGGGTGGGGG + Intergenic
1051976526 9:22956927-22956949 TCCTGGAGGTAGGGGAGGGGAGG - Intergenic
1051992025 9:23163037-23163059 TGCTTGAGGTTGGGGAGGGGTGG - Intergenic
1052582299 9:30373790-30373812 TGCTGGTGGTGAGTGAGGGGTGG - Intergenic
1052853350 9:33391532-33391554 TCCTGGCTGTGGGGGAGAGTTGG - Intronic
1053003401 9:34589990-34590012 TGCTGGGCGAGTGGGAGTGGGGG - Intronic
1053157774 9:35792243-35792265 TGCTGGGGGCCGGGGAGAGGAGG - Exonic
1053162079 9:35820072-35820094 TGATGGAGGTGAGGGGGTGGGGG + Intronic
1053316822 9:37059154-37059176 TGTTGGGGGTGGGGGAGGAGGGG - Intergenic
1053616697 9:39774414-39774436 TGCAGGCAGTGAGAGAGTGGTGG - Intergenic
1053681382 9:40487704-40487726 TCCTGGCTGTGGGGGAGAGTTGG - Intergenic
1053685178 9:40514471-40514493 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1053874862 9:42533731-42533753 TGCAGGCAGTGAGAGAGTGGTGG - Intergenic
1053897753 9:42760859-42760881 TGCAGGCAGTGAGAGAGTGGTGG + Intergenic
1053931371 9:43116034-43116056 TCCTGGCTGTGGGGGAGAGTTGG - Intergenic
1053935139 9:43142761-43142783 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1054236820 9:62567969-62567991 TGCAGGCAGTGAGAGAGTGGTGG + Intergenic
1054267471 9:62933024-62933046 TGCAGGCAGTGAGAGAGTGGTGG + Intergenic
1054278551 9:63110492-63110514 CTCTGGAGGTGGGGAAGTGGGGG + Intergenic
1054282331 9:63137230-63137252 TCCTGGCTGTGGGGGAGAGTTGG + Intergenic
1054294471 9:63323220-63323242 TCCTGGCTGTGGGGGAGAGTTGG - Intergenic
1054298270 9:63349928-63349950 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1054392492 9:64627708-64627730 TCCTGGCTGTGGGGGAGAGTTGG - Intergenic
1054396287 9:64654445-64654467 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1054427140 9:65132917-65132939 TCCTGGCTGTGGGGGAGAGTTGG - Intergenic
1054430930 9:65159640-65159662 CTCTGGAGGTGGGGAAGTGGGGG - Intergenic
1054499451 9:65861881-65861903 CTCTGGAGGTGGGGAAGTGGGGG + Intergenic
1054503235 9:65888622-65888644 TCCTGGCTGTGGGGGAGAGTTGG + Intronic
1054550957 9:66602477-66602499 TGCAGGCAGTGAGAGAGTGGTGG + Intergenic
1054838637 9:69709420-69709442 TGATGGTGGTAGGGGGGTGGAGG - Intergenic
1055512956 9:77013348-77013370 TGGTGGTGGTGGTGGAGTTGGGG - Intergenic
1056102434 9:83312737-83312759 GGGCGGCGGAGGGGGAGTGGTGG - Intronic
1056305921 9:85289996-85290018 TGGGGGGGGTGGGGGGGTGGGGG + Intergenic
1056540537 9:87567373-87567395 TACAGGCTGTGGGGGAATGGGGG + Intronic
1056806189 9:89730810-89730832 AGCTGGGGGTGGTGGAGCGGCGG + Intergenic
1056843729 9:90019386-90019408 TGCTGCCTTTGGGGGAATGGAGG + Intergenic
1057170519 9:92960653-92960675 TGCTGGCAATGGGAGAGTTGTGG + Intronic
1057212422 9:93207359-93207381 TGCTGCCTGTAGGGGAATGGTGG - Intronic
1057222274 9:93263762-93263784 TGGTGGGGGTGGGGGCATGGTGG + Intronic
1057222287 9:93263790-93263812 TGGTGGGGGTGGGGCCGTGGCGG + Intronic
1057390496 9:94638619-94638641 TGCTTGCGGGGGGGGCGGGGGGG + Intronic
1057587723 9:96344708-96344730 AGCTGGGGGTGGGGGAGGGATGG + Intronic
1057940037 9:99273800-99273822 TGTTGGGGGTGGAGGACTGGGGG + Intergenic
1058541397 9:106015854-106015876 TGTGGGGGGTGGGGGGGTGGGGG + Intergenic
1058609338 9:106757774-106757796 TGGTGGTGGTGGGGGGGTGGTGG + Intergenic
1058620404 9:106877174-106877196 TGGTGGTGGTGGTGGTGTGGTGG + Intronic
1058800485 9:108540409-108540431 TGCTGGGGGTAGGGTGGTGGTGG + Intergenic
1059517531 9:114909659-114909681 TGCTGGTGGTGGGGGTGGGAAGG + Intronic
1059941246 9:119362042-119362064 GGTTGGGGGTGGGGGGGTGGTGG - Intronic
1060404317 9:123365771-123365793 TGGTGGTGGTTGGGGGGTGGGGG - Intronic
1060812525 9:126617902-126617924 TGCTGGGGGTGGGGGGTGGGGGG + Intronic
1061180474 9:129022467-129022489 AGAAGGAGGTGGGGGAGTGGTGG + Intronic
1061403685 9:130382286-130382308 TGCTGGTGCTGAGTGAGTGGCGG + Intronic
1061403760 9:130382658-130382680 GGCTGGGGGTGGGGGAGAGGGGG - Intronic
1061589619 9:131590013-131590035 GGCTGAGGGTGGTGGAGTGGAGG + Intronic
1061743349 9:132722973-132722995 TGGCGGCGGTGGGGGAGGTGTGG - Intergenic
1061818107 9:133208086-133208108 GGTTGGCGGTGGGGGAGGGTGGG + Intronic
1061990802 9:134157597-134157619 TGCTGTTGGTGGGGGCGTGTGGG + Intronic
1062021438 9:134321220-134321242 TGCTGGCAGTGTGGGGGTGGAGG + Intronic
1062022273 9:134325343-134325365 AGCTCGCGGTGGGGGTGCGGAGG + Intronic
1062024093 9:134332508-134332530 TGCTGCCTGTGGAGGAGGGGTGG + Intronic
1062266674 9:135689706-135689728 GGCTGGCGGTGGGTGCGTGTCGG - Intergenic
1062292186 9:135800923-135800945 TACTGGGGGTTGGGGAGGGGAGG + Intergenic
1062317923 9:135977641-135977663 TGCTGGGGGTGGAGGTCTGGGGG - Intergenic
1062451387 9:136617172-136617194 TGATGGGGGTGTGGGATTGGGGG + Intergenic
1062556277 9:137114636-137114658 TCCAGGCGGGGGGTGAGTGGCGG - Exonic
1062564359 9:137157345-137157367 TGGTGGTGCTGGGGGTGTGGGGG - Intronic
1062584988 9:137245169-137245191 TGCTGGCGGCGGGCGGGGGGTGG + Exonic
1062598681 9:137310573-137310595 TGCTGGGGGTGGGGGCAGGGAGG + Intronic
1062629528 9:137457654-137457676 AGCTGGCGGTGGTGAAGGGGCGG - Exonic
1062694533 9:137866669-137866691 TGCTGAGGGTGGGAGAGTCGAGG - Intronic
1062694544 9:137866712-137866734 TGCTGAGGGTGGGAGAGTTGAGG - Intronic
1062694555 9:137866755-137866777 TGCTGAGGGTGGGAGAGTCGAGG - Intronic
1062694567 9:137866798-137866820 TGCTGAGGGTGGGAGAGTCGAGG - Intronic
1062694578 9:137866841-137866863 TGCTGAGGGTGGGAGAGTCGAGG - Intronic
1203666294 Un_KI270754v1:22413-22435 TTCAGGCGGTGTGGGAGAGGGGG + Intergenic
1203668591 Un_KI270754v1:33691-33713 TTCAGGCGGTGTGGGAGAGGGGG + Intergenic
1203669438 Un_KI270754v1:37917-37939 TTCAGGCGGTGTGGGAGAGGGGG + Intergenic
1185506991 X:638977-638999 AGGTGGTGGTGGGGGAGAGGAGG + Intronic
1185525036 X:771843-771865 GGCAGGGGGTGGGGGAGAGGGGG - Intergenic
1185760237 X:2685001-2685023 TGTTGGAGGTGGGGGCCTGGTGG - Intergenic
1186712202 X:12210714-12210736 TGTTGTCGGTGGGGGAGGCGGGG - Intronic
1186899537 X:14038672-14038694 TGCTGGTGGTGGGGAAGGAGGGG + Intergenic
1187425890 X:19176847-19176869 TGCTGGGGGTGGGGCGGGGGGGG - Intergenic
1187572419 X:20518635-20518657 TGCAGCCGGGGGAGGAGTGGTGG - Intergenic
1187610720 X:20939863-20939885 TGCTGGGGGTAAGGGAGGGGTGG + Intergenic
1188538959 X:31228104-31228126 TGGTGGGGTGGGGGGAGTGGGGG + Intronic
1189281577 X:39822853-39822875 TGGTGGTGGTGGGGCGGTGGGGG - Intergenic
1189317109 X:40064100-40064122 TTCTGGCTTTGGGGGAGGGGAGG + Intronic
1189420070 X:40849049-40849071 TGCAGGTGGTTGGGGAATGGGGG - Intergenic
1189450640 X:41125624-41125646 TGTTGGCGGGAGGGGTGTGGGGG - Intronic
1189581945 X:42415427-42415449 GGCTGGAGGTGGGTGGGTGGGGG + Intergenic
1189760266 X:44315001-44315023 TGTTGGAGGTGGGGGCCTGGTGG + Intronic
1189804267 X:44719624-44719646 GGCTGGGGGTGGGGTGGTGGAGG - Intergenic
1189834450 X:45005956-45005978 TGGGGGGGGTGGGGGGGTGGGGG - Intronic
1190066477 X:47244995-47245017 GGCTGGGGGTGAGGGAGAGGTGG - Exonic
1190562104 X:51696076-51696098 TGTTGGGGGGGGGGGAGGGGCGG + Intergenic
1190654475 X:52598883-52598905 TGGGGGCGGTGGCGGGGTGGGGG - Intergenic
1190929194 X:54933953-54933975 GGCTGGTGATGGGGGAGGGGAGG - Intronic
1191038982 X:56058498-56058520 TGTTGGCGGTGGGGGTGGGTGGG - Intergenic
1191213458 X:57911618-57911640 TGGTGGTGGTGGGGGTGGGGGGG + Intergenic
1191677182 X:63803745-63803767 TGCTGGGGGTTGGGGGCTGGGGG + Intergenic
1191824357 X:65348080-65348102 TGGTGGGGTGGGGGGAGTGGGGG + Intergenic
1192631586 X:72781781-72781803 TGGTGGTGGTGGGGTTGTGGAGG - Intronic
1192650123 X:72939020-72939042 TGGTGGTGGTGGGGTTGTGGAGG + Intronic
1192853166 X:74979714-74979736 TGCTGGGGGTGGGAGAGGGATGG - Intergenic
1193076360 X:77360001-77360023 TGGTGGCGGAGTGGGGGTGGAGG + Intergenic
1193094122 X:77528032-77528054 TGGGGGTGGTGGGGGGGTGGGGG + Intronic
1193095778 X:77547278-77547300 TGCTGGCAGTGTTGGGGTGGAGG - Intronic
1193645708 X:84066416-84066438 TGGTGGCGGCGGGGGCGGGGGGG + Intronic
1193659958 X:84245529-84245551 CTCTGGCGGTGGGGGGGCGGGGG - Intergenic
1193815612 X:86101781-86101803 TGCCTGGGGTGGGGGAGGGGTGG - Intergenic
1193925353 X:87477068-87477090 TGCAGGGGGTGGGGAAGTGGTGG + Intergenic
1193930191 X:87543492-87543514 TGCTGGGTGTTGGGGAGGGGTGG - Intronic
1193942138 X:87689101-87689123 TCGTGGGGTTGGGGGAGTGGGGG + Intergenic
1194035305 X:88863854-88863876 TGCTCGCGGGGGAGGTGTGGAGG + Intergenic
1194147696 X:90282853-90282875 TTCTAGGGGTGGGGAAGTGGTGG + Intergenic
1194348166 X:92792800-92792822 TGTTGGCGGTGGTGAAGGGGTGG - Intergenic
1194646183 X:96460986-96461008 TTCTGAGGGTGGTGGAGTGGTGG - Intergenic
1194770958 X:97904056-97904078 TGGTGGCGGAGGTGGTGTGGTGG - Intergenic
1194855391 X:98921477-98921499 TGGTGGTGATGGGGGGGTGGTGG - Intergenic
1195144575 X:102000306-102000328 TGCTGGCAGTGTGGTAGGGGTGG - Intergenic
1195255020 X:103081952-103081974 TGCTGGTCCTGGGGAAGTGGGGG + Intronic
1195642205 X:107188428-107188450 TGGCGGGGCTGGGGGAGTGGTGG - Intronic
1195685687 X:107583234-107583256 TGTTGGGGGTGGGGGAGCGAGGG - Intronic
1195817260 X:108902568-108902590 TCGTGGTGGTGGGGGTGTGGTGG + Intergenic
1196536377 X:116850311-116850333 TGTTGGGGGTGGGGGTGTTGGGG - Intergenic
1196810489 X:119625260-119625282 TGTTGGGGGTGCGGGATTGGGGG + Intronic
1197068800 X:122267750-122267772 TGCTGGGGTTGGAGGAGTGGTGG + Intergenic
1197536023 X:127690204-127690226 TGCTGGGGGTGGAAGAGAGGTGG + Intergenic
1197769931 X:130083261-130083283 TGGTGGGGGTGGGGTGGTGGTGG - Intronic
1198258332 X:134944786-134944808 TGGGGGCGGTGGGGGGGGGGGGG - Intergenic
1199034097 X:143031395-143031417 TGATGGTGGTAGGGGGGTGGGGG + Intronic
1199080070 X:143567175-143567197 TGTTGGGGGTGGGGGTGTGGAGG + Intergenic
1199286986 X:146064803-146064825 TGCGGGGGGTGGGGGGGGGGTGG - Intergenic
1199358184 X:146885852-146885874 TGCTGGGGGTCGGGGAGGGGTGG - Intergenic
1199617844 X:149671819-149671841 TGGTGATGGTGGGGGAGGGGTGG + Intergenic
1199624798 X:149731430-149731452 TGGTGATGGTGGGGGAGGGGTGG - Intergenic
1199699067 X:150363326-150363348 TGCTGGCGGCGCTGCAGTGGCGG - Intronic
1199726725 X:150590429-150590451 TGCTGGAGGATTGGGAGTGGTGG + Intronic
1199901110 X:152173231-152173253 TAAAGGCGGTGGGGGGGTGGGGG + Intronic
1199954555 X:152733578-152733600 TGGTGGGGTTGGGGGAGTTGGGG - Intronic
1200064178 X:153496954-153496976 TGCTGGGGGGTGGGGGGTGGGGG - Intronic
1200268083 X:154656958-154656980 TGTTGGGGGTGGGGGGCTGGGGG + Intergenic
1200420180 Y:2956680-2956702 TGGGGGCGGGGGGGGGGTGGGGG - Intronic
1200487541 Y:3787031-3787053 TGGTGGGGGCGGGGGGGTGGGGG + Intergenic
1200656495 Y:5909429-5909451 TGTTGGCGGTGGTGAAGGGGTGG - Intergenic
1200746780 Y:6910514-6910536 AGCTGGCTGTTGGGGAGGGGCGG + Intergenic
1202587938 Y:26451672-26451694 GGGGGGCGGTGGGTGAGTGGTGG - Intergenic