ID: 1081675207

View in Genome Browser
Species Human (GRCh38)
Location 11:44964664-44964686
Sequence GGAGCAGGTGTCTGCAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081675207_1081675216 20 Left 1081675207 11:44964664-44964686 CCACGCCTGCAGACACCTGCTCC No data
Right 1081675216 11:44964707-44964729 GGGGTGATCAGCTCTGCAAAGGG No data
1081675207_1081675215 19 Left 1081675207 11:44964664-44964686 CCACGCCTGCAGACACCTGCTCC No data
Right 1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG No data
1081675207_1081675213 0 Left 1081675207 11:44964664-44964686 CCACGCCTGCAGACACCTGCTCC No data
Right 1081675213 11:44964687-44964709 TCAGCTTTGGAGATAATCGCGGG No data
1081675207_1081675214 1 Left 1081675207 11:44964664-44964686 CCACGCCTGCAGACACCTGCTCC No data
Right 1081675214 11:44964688-44964710 CAGCTTTGGAGATAATCGCGGGG No data
1081675207_1081675212 -1 Left 1081675207 11:44964664-44964686 CCACGCCTGCAGACACCTGCTCC No data
Right 1081675212 11:44964686-44964708 CTCAGCTTTGGAGATAATCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081675207 Original CRISPR GGAGCAGGTGTCTGCAGGCG TGG (reversed) Intergenic
No off target data available for this crispr