ID: 1081675210

View in Genome Browser
Species Human (GRCh38)
Location 11:44964679-44964701
Sequence TATCTCCAAAGCTGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081675210_1081675217 20 Left 1081675210 11:44964679-44964701 CCTGCTCCTCAGCTTTGGAGATA No data
Right 1081675217 11:44964722-44964744 GCAAAGGGCCTCACAGCTGCTGG No data
1081675210_1081675216 5 Left 1081675210 11:44964679-44964701 CCTGCTCCTCAGCTTTGGAGATA No data
Right 1081675216 11:44964707-44964729 GGGGTGATCAGCTCTGCAAAGGG No data
1081675210_1081675215 4 Left 1081675210 11:44964679-44964701 CCTGCTCCTCAGCTTTGGAGATA No data
Right 1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG No data
1081675210_1081675218 21 Left 1081675210 11:44964679-44964701 CCTGCTCCTCAGCTTTGGAGATA No data
Right 1081675218 11:44964723-44964745 CAAAGGGCCTCACAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081675210 Original CRISPR TATCTCCAAAGCTGAGGAGC AGG (reversed) Intergenic