ID: 1081675211

View in Genome Browser
Species Human (GRCh38)
Location 11:44964685-44964707
Sequence CGCGATTATCTCCAAAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081675211_1081675215 -2 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG No data
1081675211_1081675217 14 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675217 11:44964722-44964744 GCAAAGGGCCTCACAGCTGCTGG No data
1081675211_1081675221 30 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675221 11:44964738-44964760 CTGCTGGGCCTGAACCAAAAGGG No data
1081675211_1081675216 -1 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675216 11:44964707-44964729 GGGGTGATCAGCTCTGCAAAGGG No data
1081675211_1081675218 15 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675218 11:44964723-44964745 CAAAGGGCCTCACAGCTGCTGGG No data
1081675211_1081675220 29 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675220 11:44964737-44964759 GCTGCTGGGCCTGAACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081675211 Original CRISPR CGCGATTATCTCCAAAGCTG AGG (reversed) Intergenic
No off target data available for this crispr