ID: 1081675214

View in Genome Browser
Species Human (GRCh38)
Location 11:44964688-44964710
Sequence CAGCTTTGGAGATAATCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081675206_1081675214 28 Left 1081675206 11:44964637-44964659 CCTTTTCTTTCAGAGGTAGGAGC No data
Right 1081675214 11:44964688-44964710 CAGCTTTGGAGATAATCGCGGGG No data
1081675207_1081675214 1 Left 1081675207 11:44964664-44964686 CCACGCCTGCAGACACCTGCTCC No data
Right 1081675214 11:44964688-44964710 CAGCTTTGGAGATAATCGCGGGG No data
1081675208_1081675214 -4 Left 1081675208 11:44964669-44964691 CCTGCAGACACCTGCTCCTCAGC No data
Right 1081675214 11:44964688-44964710 CAGCTTTGGAGATAATCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081675214 Original CRISPR CAGCTTTGGAGATAATCGCG GGG Intergenic
No off target data available for this crispr