ID: 1081675215

View in Genome Browser
Species Human (GRCh38)
Location 11:44964706-44964728
Sequence CGGGGTGATCAGCTCTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081675208_1081675215 14 Left 1081675208 11:44964669-44964691 CCTGCAGACACCTGCTCCTCAGC No data
Right 1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG No data
1081675207_1081675215 19 Left 1081675207 11:44964664-44964686 CCACGCCTGCAGACACCTGCTCC No data
Right 1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG No data
1081675211_1081675215 -2 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG No data
1081675210_1081675215 4 Left 1081675210 11:44964679-44964701 CCTGCTCCTCAGCTTTGGAGATA No data
Right 1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081675215 Original CRISPR CGGGGTGATCAGCTCTGCAA AGG Intergenic
No off target data available for this crispr