ID: 1081675218

View in Genome Browser
Species Human (GRCh38)
Location 11:44964723-44964745
Sequence CAAAGGGCCTCACAGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081675211_1081675218 15 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675218 11:44964723-44964745 CAAAGGGCCTCACAGCTGCTGGG No data
1081675210_1081675218 21 Left 1081675210 11:44964679-44964701 CCTGCTCCTCAGCTTTGGAGATA No data
Right 1081675218 11:44964723-44964745 CAAAGGGCCTCACAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081675218 Original CRISPR CAAAGGGCCTCACAGCTGCT GGG Intergenic
No off target data available for this crispr