ID: 1081675218 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:44964723-44964745 |
Sequence | CAAAGGGCCTCACAGCTGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1081675210_1081675218 | 21 | Left | 1081675210 | 11:44964679-44964701 | CCTGCTCCTCAGCTTTGGAGATA | No data | ||
Right | 1081675218 | 11:44964723-44964745 | CAAAGGGCCTCACAGCTGCTGGG | No data | ||||
1081675211_1081675218 | 15 | Left | 1081675211 | 11:44964685-44964707 | CCTCAGCTTTGGAGATAATCGCG | 0: 1 1: 0 2: 0 3: 3 4: 47 |
||
Right | 1081675218 | 11:44964723-44964745 | CAAAGGGCCTCACAGCTGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1081675218 | Original CRISPR | CAAAGGGCCTCACAGCTGCT GGG | Intergenic | ||