ID: 1081675221

View in Genome Browser
Species Human (GRCh38)
Location 11:44964738-44964760
Sequence CTGCTGGGCCTGAACCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081675211_1081675221 30 Left 1081675211 11:44964685-44964707 CCTCAGCTTTGGAGATAATCGCG No data
Right 1081675221 11:44964738-44964760 CTGCTGGGCCTGAACCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081675221 Original CRISPR CTGCTGGGCCTGAACCAAAA GGG Intergenic
No off target data available for this crispr