ID: 1081676779

View in Genome Browser
Species Human (GRCh38)
Location 11:44974571-44974593
Sequence CCTGGAGTCTGGCTCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081676779_1081676784 3 Left 1081676779 11:44974571-44974593 CCAGGGCTGAGCCAGACTCCAGG No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081676779 Original CRISPR CCTGGAGTCTGGCTCAGCCC TGG (reversed) Intergenic
No off target data available for this crispr