ID: 1081676784

View in Genome Browser
Species Human (GRCh38)
Location 11:44974597-44974619
Sequence CCTCCAGCCACCCGTGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081676778_1081676784 4 Left 1081676778 11:44974570-44974592 CCCAGGGCTGAGCCAGACTCCAG No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data
1081676781_1081676784 -8 Left 1081676781 11:44974582-44974604 CCAGACTCCAGGCAGCCTCCAGC No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data
1081676772_1081676784 15 Left 1081676772 11:44974559-44974581 CCACCCCCTTCCCCAGGGCTGAG No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data
1081676776_1081676784 9 Left 1081676776 11:44974565-44974587 CCTTCCCCAGGGCTGAGCCAGAC No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data
1081676779_1081676784 3 Left 1081676779 11:44974571-44974593 CCAGGGCTGAGCCAGACTCCAGG No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data
1081676777_1081676784 5 Left 1081676777 11:44974569-44974591 CCCCAGGGCTGAGCCAGACTCCA No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data
1081676773_1081676784 12 Left 1081676773 11:44974562-44974584 CCCCCTTCCCCAGGGCTGAGCCA No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data
1081676775_1081676784 10 Left 1081676775 11:44974564-44974586 CCCTTCCCCAGGGCTGAGCCAGA No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data
1081676774_1081676784 11 Left 1081676774 11:44974563-44974585 CCCCTTCCCCAGGGCTGAGCCAG No data
Right 1081676784 11:44974597-44974619 CCTCCAGCCACCCGTGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081676784 Original CRISPR CCTCCAGCCACCCGTGCCTC CGG Intergenic
No off target data available for this crispr